TkA03G495160 | RubberDandelionOmics

Gene overview

TkA03G495160

Reference: TK1151 Chr: Chr03 Coordinates: 124290585-124293897 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1110 bp · TkA03G495160|TK1151|cDNA

TAAAGACATTGAAGCCACAACAAAAGAAGACCAATCCAGATAATATAGATTTTTCATGTTATGTATTTATTATACCTTATATCTAAATTAGGTTTAGTATCGGCTCATCTTCTCTTTCGACGGCTTCATTGTTTTACCGCTGATTTCCTTCTGTTTCTTTCTGGCGCGGCTGGCCTTCACATGCGCCGTCGGCGTTTTCGTAACAGTGCCTGTTGACGACTGCTTCGATCATTTTGCCCGTTCTTATTTCCCTGTGTATT...

CDS

Download CDS FASTA

1455 bp · TkA03G495160|TK1151|CDS

ATGGCTCCCGATCTCCCCAGTGACTCCGAACCGTACCTTGTGCTGCGGAATCATATACCCATTTCTACAAATTCGACGCCCTTGCCGGAAACCTCCGCCCCTGAATTTTTCTCTCTCGATGTCGACGCTGATGATTGGAGAACCCCGACGCCGCCGCTCAAACGGTCGCGATTGGCCCCTGCTTTACCTGATGAAGAACCCAAGAGAAGTCTCGAGGCCGGTTGGTTTCGTGCCAATTGTCGGTTTAAGAGCCCCATGCT...

Protein

Download Protein FASTA

484 aa · TkA03G495160|TK1151|PROTEIN

MAPDLPSDSEPYLVLRNHIPISTNSTPLPETSAPEFFSLDVDADDWRTPTPPLKRSRLAPALPDEEPKRSLEAGWFRANCRFKSPMLQLHKEILDFCDFLSPTPEEAVSRNTAVESVSDVIKYIWPTCKVEVFGYFKTGLFLPSSDVDMVILDSHIRTPQLGLHALSRALSQKGVAKKIQVIAKARVPIIKFVERKSGISFDVSFDMENGPKAAEYIQDAISKWPQLRPLCLIMKVFLQQQELNEVYSGGIGSYALLAML...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G495160`
TK1151 ID	TkA03G495160
OH-1004 ID	LXL04_001985
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.900
Protein coverage (%)	TK1151 99.793 / OH-1004 94.347 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G495160`
Location	Chr03:124290585-124293897 (+)
Description	Similar to TENT4B: Terminal nucleotidyltransferase 4B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001985` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006302 double-strand break repair Biological Process GO:0006364 rRNA processing Biological Process GO:0006397 mRNA processing Biological Process GO:0006401 RNA catabolic process Biological Process GO:0007062 sister chromatid cohesion Biological Process GO:0007076 mitotic chromosome condensation Biological Process GO:0009410 response to xenobiotic stimulus Biological Process GO:0010587 miRNA catabolic process Biological Process GO:0031123 RNA 3'-end processing Biological Process GO:0031124 mRNA 3'-end processing Biological Process GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process GO:0033500 carbohydrate homeostasis Biological Process
KEGG gene cross-reference	dme:Dmel_CG11265 hsa:11044 hsa:64282 mmu:210106 mmu:214627 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.916

Rank 1 · TkA03G495160 · TK1151

Cytoplasm0.123

Rank 2 · TkA03G495160 · TK1151

Cell membrane0.027

Rank 3 · TkA03G495160 · TK1151

Endoplasmic reticulum0.019

Rank 4 · TkA03G495160 · TK1151

Plastid0.015

Rank 5 · TkA03G495160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22600MTPAP-like_central89-212 aa

PF19088TUTase105-204 aa

PF01909NTP_transf_2117-212 aa

PF20750PAP_NTPase128-205 aa

PF03828PAP_assoc277-335 aa

PF14657Arm-DNA-bind_4435-457 aa

PF03828PAP_assoc438-456 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G495160	`PF22600`	MTPAP-like_central	89	212	8.1e-23	81.8
TkA03G495160	`PF19088`	TUTase	105	204	0.002	18.6
TkA03G495160	`PF01909`	NTP_transf_2	117	212	0.00034	21.6
TkA03G495160	`PF20750`	PAP_NTPase	128	205	0.00057	20.5
TkA03G495160	`PF03828`	PAP_assoc	277	335	2.6e-18	66.8
TkA03G495160	`PF14657`	Arm-DNA-bind_4	435	457	0.078	13.5
TkA03G495160	`PF03828`	PAP_assoc	438	456	2.6e-18	66.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card