TkA03G483350 | RubberDandelionOmics

Gene overview

TkA03G483350

Reference: TK1151 Chr: Chr03 Coordinates: 120896188-120899126 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1381 bp · TkA03G483350|TK1151|cDNA

CTCGTATCAAACAGAAAATGAGGAAGAGAAAAATAGAAAAAAAAACCAACTCCAAGAGATGAAACGATGAAAAAGACAAAAACGTGAAAAGCAAAGCATACCGATAGTAATAGATGACTTGCCTTTGGACTTTCTTTCTTCCTTCAGCCCGGAAGGAGATAGCATAGCCATAGCCATAGCAGGCGCAATCCAATCATCCTCCATCCATTGCCGATTCGATTCATTTTTTTTTTTTTTTTTTTGTTAGCCTCATCTCCTCC...

CDS

Download CDS FASTA

693 bp · TkA03G483350|TK1151|CDS

ATGGATGTGGTGAGTGGAGGTAATGGTCATGACAGCTCAAGTTTAGCTTCTAAACAACGCCTTCGTTGGACTCATGAGCTTCATGAACGATTTGTTGATGCTGTGGCACAATTGGGCGGCCCTGATAGGGCTACCCCAAAAGGTGTGCTGAGAGTGATGGGTGTTCAAGGTCTAACAATTTATCATGTCAAGAGCCACTTGCAGAAATATAGGCTCGCAAAGTATCTTCCAGATTCCTCTTCTGAAGGAAAAGCATTTGA...

Protein

Download Protein FASTA

230 aa · TkA03G483350|TK1151|PROTEIN

MDVVSGGNGHDSSSLASKQRLRWTHELHERFVDAVAQLGGPDRATPKGVLRVMGVQGLTIYHVKSHLQKYRLAKYLPDSSSEGKAFDQKESGEMLSSLDGSSGMQITEALKLQMEVQKRLHEQLEVQRQLQLRIEAQGKYLKKIIEEQQKLTGVLSEQDNTCPQPKPPPPVIIENPTPVNTIKPREPLTPEDSGLDRIAKKQRVELTHQILESSLRQQHSVYGMSVNNEG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G483350`
TK1151 ID	TkA03G483350
OH-1004 ID	LXL04_009931
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G483350

Location Chr03:120896188-120899126 (+)

Description Similar to PHL7: Myb family transcription factor PHL7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g01060`	Myb family transcription factor PHL7.	No verified direct reference in this release
`At4g28610`	Transcription factor involved in phosphate starvation signaling.	The Arabidopsis transcription factor PHR1 is essential for adaptation to high light and retaining functional photosynthesis during phosphate starvation.2012 · DOI: 10.1111/j.1399-3054.2011.01520.x

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XYN9`	Transcription factor binding to specific DNA sequences of target genes promoters, such as the motif R1BS 5'-NAKATNCN-3' and the motif P1BS 5'-GNATATNC-3' to trigger their expression (By similarity).	No verified direct reference in this release
`Os04g0665600`	Transcription factor binding to specific DNA sequences of target genes promoters, such as the motif R1BS 5'-NAKATNCN-3' and the motif P1BS 5'-GNATATNC-3' to trigger their expression.	An SPX-RLI1 Module Regulates Leaf Inclination in Response to Phosphate Availability in Rice.2018 · DOI: 10.1105/tpc.17.00738 Modulation of nitrate-induced phosphate response by the MYB transcription factor RLI1/HINGE1 in the nucleus.2021 · DOI: 10.1016/j.molp.2020.12.005
`UniProt: A2X0Q0`	Transcription factor involved in phosphate starvation signaling.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009931 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010167 response to nitrate Biological Process

GO:0010966 regulation of phosphate transport Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0016132 brassinosteroid biosynthetic process Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048768 root hair cell tip growth Biological Process

GO:0051511 negative regulation of unidimensional cell growth Biological Process

GO:2000024 regulation of leaf development Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT2G01060

dosa:Os03g0329900

dosa:Os04g0665600

osa:4337318

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.966

Rank 1 · TkA03G483350 · TK1151

Cytoplasm0.121

Rank 2 · TkA03G483350 · TK1151

Cell membrane0.018

Rank 3 · TkA03G483350 · TK1151

Mitochondrion0.014

Rank 4 · TkA03G483350 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA03G483350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding20-71 aa

PF14379Myb_CC_LHEQLE104-150 aa

PF07325Curto_V2110-160 aa

PF28692LD_N119-154 aa

PF28692LD_N199-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G483350	`PF00249`	Myb_DNA-binding	20	71	6.3e-10	39.7
TkA03G483350	`PF14379`	Myb_CC_LHEQLE	104	150	1e-23	83.5
TkA03G483350	`PF07325`	Curto_V2	110	160	0.026	15.1
TkA03G483350	`PF28692`	LD_N	119	154	3.1	8.4
TkA03G483350	`PF28692`	LD_N	199	210	3.1	8.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJW0`	Arabidopsis thaliana	sp\|Q9SJW0\|PHL7_ARATH Myb family transcription factor PHL7	91.800%	Swiss-Prot	Low
`Q94CL7`	Arabidopsis thaliana	sp\|Q94CL7\|PHR1_ARATH Protein PHOSPHATE STARVATION RESPONSE 1	62.000%	Swiss-Prot	Low
`A2XYN9`	Oryza sativa subsp. indica	sp\|A2XYN9\|RLI1_ORYSI Myb family transcription factor RLI1	61.000%	Swiss-Prot	Low
`Q0J995`	Oryza sativa subsp. japonica	sp\|Q0J995\|RLI1_ORYSJ Myb family transcription factor RLI1	61.000%	Swiss-Prot	Low
`A2X0Q0`	Oryza sativa subsp. indica	sp\|A2X0Q0\|PHR3_ORYSI Protein PHOSPHATE STARVATION RESPONSE 3	53.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card