TkA03G479570 | RubberDandelionOmics

Gene overview

TkA03G479570

Reference: TK1151 Chr: Chr03 Coordinates: 119902133-119905549 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2160 bp · TkA03G479570|TK1151|cDNA

AAAAACAACGAGTAAAAATCAAAGTTGAAGGATTAAGCAAAACCAATAACAATAGAAAACGCTTTTACAAATCCCACGCTACGATTTGAAGAATACTTTATATTATCCCCTCTCTTCCTCTGCAAACCCTAATCCCTTTCTTTTGATTTTCCTTATTATCTTCTACCCTAAAAGAGATCTTCAGCTCCTTTCTCCGGATTATTTTGCTCCGAATTGCTGTTTTCAGTCGGTTTTGTTTTGCTTGATGGATTCTGGATCTT...

CDS

Download CDS FASTA

1365 bp · TkA03G479570|TK1151|CDS

ATGGATTCTGGATCTTCCAAAGGATTCGATTTTGCATCCGACGACATTCTCTGCTCATACGAAGATTACACAAATCAGGAAAATTCCAACGGAAGTCACGCAGCTTCTGCGATCGCCACTAATTCCTCTAAAGAGTTCAACAAAAGCAGGATGAGTAGACCAACATTCCCGGCTTCTTCATATAGCCCACCGGATGATTCTGGCAACCAAGATGTGGTCATTGCTGCTGTTGAGAGATCCATGAAGAAACATTCTGAAAA...

Protein

Download Protein FASTA

454 aa · TkA03G479570|TK1151|PROTEIN

MDSGSSKGFDFASDDILCSYEDYTNQENSNGSHAASAIATNSSKEFNKSRMSRPTFPASSYSPPDDSGNQDVVIAAVERSMKKHSENLMRFLEGLSSRLSQLELYCYNVDKSVGEMRSDLARDHGESETKLKFLEKHLQEVHRSVQIIRDKQELADTQKELAKLQLAHKESEKAEEVSTPSSDKRNDNPPDVHNQQLALALPQPPPAAHQPPMTQQQTYYLSPSPAPPQPNMPQSHYLQPDPHYQTQVSQPPPQPRPQMS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G479570`
TK1151 ID	TkA03G479570
OH-1004 ID	LXL04_009873
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G479570`
Location	Chr03:119902133-119905549 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009873` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.640

Rank 1 · TkA03G479570 · TK1151

Nucleus0.279

Rank 2 · TkA03G479570 · TK1151

Cell membrane0.115

Rank 3 · TkA03G479570 · TK1151

Golgi apparatus0.108

Rank 4 · TkA03G479570 · TK1151

Endoplasmic reticulum0.081

Rank 5 · TkA03G479570 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02601Exonuc_VII_L73-170 aa

PF28819GSCFA_C79-105 aa

PF23831DUF720180-148 aa

PF01496V_ATPase_I84-178 aa

PF00494SQS_PSY99-131 aa

PF14276DUF4363105-177 aa

PF21982RecX_HTH1110-122 aa

PF28819GSCFA_C124-161 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G479570	`PF02601`	Exonuc_VII_L	73	170	0.029	14.6
TkA03G479570	`PF28819`	GSCFA_C	79	105	0.099	13.4
TkA03G479570	`PF23831`	DUF7201	80	148	0.08	13.4
TkA03G479570	`PF01496`	V_ATPase_I	84	178	1.4	7.5
TkA03G479570	`PF00494`	SQS_PSY	99	131	0.064	13.7
TkA03G479570	`PF14276`	DUF4363	105	177	0.042	14.6
TkA03G479570	`PF21982`	RecX_HTH1	110	122	0.24	12.1
TkA03G479570	`PF28819`	GSCFA_C	124	161	0.099	13.4
TkA03G479570	`PF21982`	RecX_HTH1	400	426	0.24	12.1
TkA03G479570	`PF07223`	DUF1421	402	445	3.7e-21	75.4
TkA03G479570	`PF08587`	UBA_2	404	440	0.34	11.7
TkA03G479570	`PF28819`	GSCFA_C	422	443	0.099	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card