Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1528 bp · TkA03G473810|TK1151|cDNA
TTTATGGGCTACAGGACTCCTTTATTCAAGTCCGGATGCAACTACCTTGCAGTCTTGCGCATTACGCACCCACGCGCACGTTAGGGTAATCTCCCCTTTCTCCAAAATCTATATCAATCCGAACTCTAAGATTAAATTGTATCAAAGGGTTTTTTTTGTTCTCCAAGTCTTTCGAAGAGGTTCCAAATCTATCGTTAATTCGTTCTTCATCATCATCCATTAGGTTGCCGTATACTCGATTGCTGTTTAGTGAAGCTTGT...
966 bp · TkA03G473810|TK1151|CDS
ATGTATTTCGATGGTTATGGCTATCATGGAACATCCTTTGAGCAAACATATCGATGCTACCCTGCATCTTTCATTGATAAGCCACAGTTAGAAAACGGTGATAAAATTATAATGCCTCCTTCAGCCCTTGATCGCCTTGCTTCTCTTCACATTGATTATCCAATGCTGTTTGAGCTACGAAATGCTGCTACTGAGAGGATTTCACATTGTGGTGTCTTGGAATTCATTGCAGAAGAAGGCATGATTTATATGCCTTATTG...
Protein
Download Protein FASTA321 aa · TkA03G473810|TK1151|PROTEIN
MYFDGYGYHGTSFEQTYRCYPASFIDKPQLENGDKIIMPPSALDRLASLHIDYPMLFELRNAATERISHCGVLEFIAEEGMIYMPYWMMENLLLQEGDIVRVKNVTLPKGTYVKLQPHTKDFLDISNPKAILETTLRNFSCLTTGDSIMVAYNNKKYYIDIIESKPSHAITIIETDCEVDFAPPLDYKEPERPVASIPSSKTPQEGEAAAVEEPKFNPFTGSGRRLDGKPLKHHQQPPVSSSSKDKQVAVSGGGGGVAPP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G473810 |
|---|---|
| TK1151 ID | TkA03G473810 |
| OH-1004 ID | LXL04_038133 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 37.800 |
| Protein coverage (%) | TK1151 47.352 / OH-1004 29.130Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G473810 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:118451264-118454381 (-) | |||||||||
| Description | Similar to ufd1: Ubiquitin fusion degradation protein 1 homolog | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0010498 proteasomal protein catabolic process Biological Process GO:0030970 retrograde protein transport, ER to cytosol Biological Process GO:0032480 negative regulation of type I interferon production Biological Process GO:0034614 cellular response to reactive oxygen species Biological Process GO:0036503 ERAD pathway Biological Process GO:0039536 negative regulation of RIG-I signaling pathway Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0071218 cellular response to misfolded protein Biological Process GO:0072344 rescue of stalled cytosolic ribosome Biological Process GO:1902882 regulation of response to oxidative stress Biological Process GO:1990116 ribosome-associated ubiquitin-dependent protein catabolic process Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT2G21270 ath:AT4G38930 ddi:DDB_G0271122 hsa:7353 rno:84478 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF03152UFD1_N113-108 aaPF24842UFD1_N2109-184 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G473810 | PF03152 | UFD1_N1 | 13 | 108 | 1.4e-41 | 140.7 |
| TkA03G473810 | PF24842 | UFD1_N2 | 109 | 184 | 1e-36 | 125.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.