TkA03G456090 | RubberDandelionOmics

Gene overview

TkA03G456090

Reference: TK1151 Chr: Chr03 Coordinates: 113863656-113868166 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3025 bp · TkA03G456090|TK1151|cDNA

TTGAAATCAGAGCCGGCAAAGAGACCCTCACAGATGGACTCACACGAGTCATCGCCACCGTCTGTCAGCCGAGACTGGTTCTTCCCTTCCCCCTCCCCCTCCTTCTCCCACCCCTCCTCCTCCTCCCCCTCCTCCTCTCATCGTCAACATCTCCACACACCTCCTACCAGAAGGTTCTCTACCTACCCTAGACCTCCCAACCCCTCTGCTGCCGGCCCGGTCTCACGTAGTACATCGTCGTCTTCCGCCGCTTCCTCTCA...

CDS

Download CDS FASTA

1944 bp · TkA03G456090|TK1151|CDS

ATGGACTCACACGAGTCATCGCCACCGTCTGTCAGCCGAGACTGGTTCTTCCCTTCCCCCTCCCCCTCCTTCTCCCACCCCTCCTCCTCCTCCCCCTCCTCCTCTCATCGTCAACATCTCCACACACCTCCTACCAGAAGGTTCTCTACCTACCCTAGACCTCCCAACCCCTCTGCTGCCGGCCCGGTCTCACGTAGTACATCGTCGTCTTCCGCCGCTTCCTCTCATCGTGATCTCAAATATGCAGGATTCTCACGACG...

Protein

Download Protein FASTA

647 aa · TkA03G456090|TK1151|PROTEIN

MDSHESSPPSVSRDWFFPSPSPSFSHPSSSSPSSSHRQHLHTPPTRRFSTYPRPPNPSAAGPVSRSTSSSSAASSHRDLKYAGFSRRTNFSRRYQRSLMPEVDTPSVVHQIPQKCDVSNDKTSTPDKFFDFVSGRLKFRWQMAFLVALLITTFSSLLHKNISLHNQTTDLQAQITKLNGRLQVCNLLEPMDINDSDSQDIINLPNKRLKTIALSISVILLSIPFIFLKYVEYISKSRSPDNLKEEASLNKQLAYKVDVFL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G456090`
TK1151 ID	TkA03G456090
OH-1004 ID	LXL04_038788
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	65.800
Protein coverage (%)	TK1151 76.662 / OH-1004 51.175 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G456090

Location Chr03:113863656-113868166 (+)

Description Similar to DMI1: Ion channel DMI1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0843600`	Required for mycorrhizal symbiosis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038788 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006813 potassium ion transport Biological Process

GO:0034220 monoatomic ion transmembrane transport Biological Process

GO:0009507 chloroplast Cellular Component

GO:0031965 nuclear membrane Cellular Component

KEGG gene cross-reference

ath:AT5G49960

dosa:Os01g0870100

mtr:11433851

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.794

Rank 1 · TkA03G456090 · TK1151

Golgi apparatus0.075

Rank 2 · TkA03G456090 · TK1151

Cell membrane0.071

Rank 3 · TkA03G456090 · TK1151

Endoplasmic reticulum0.071

Rank 4 · TkA03G456090 · TK1151

Nucleus0.060

Rank 5 · TkA03G456090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13800Sigma_reg_N144-178 aa

PF02183HALZ152-182 aa

PF13800Sigma_reg_N206-238 aa

PF02183HALZ243-252 aa

PF02183HALZ343-354 aa

PF22614Slo-like_RCK362-467 aa

PF06241Castor_Poll_mid505-602 aa

PF02080TrkA_C568-597 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G456090	`PF13800`	Sigma_reg_N	144	178	0.27	12.2
TkA03G456090	`PF02183`	HALZ	152	182	2.6	9.0
TkA03G456090	`PF13800`	Sigma_reg_N	206	238	0.27	12.2
TkA03G456090	`PF02183`	HALZ	243	252	2.6	9.0
TkA03G456090	`PF02183`	HALZ	343	354	2.6	9.0
TkA03G456090	`PF22614`	Slo-like_RCK	362	467	5.6e-06	26.7
TkA03G456090	`PF06241`	Castor_Poll_mid	505	602	4.1e-43	146.3
TkA03G456090	`PF02080`	TrkA_C	568	597	0.00095	19.8
TkA03G456090	`PF02080`	TrkA_C	624	639	0.00095	19.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q75LD5`	Oryza sativa subsp. japonica	sp\|Q75LD5\|CASTO_ORYSJ Probable ion channel CASTOR	71.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card