TkA03G411860 | RubberDandelionOmics

Gene overview

TkA03G411860

Reference: TK1151 Chr: Chr03 Coordinates: 102432157-102433272 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1086 bp · TkA03G411860|TK1151|cDNA

ATGGTCTGGTTTAGAGGTTGTTTGATCGGTAAAGGGTGTTTTGGGTCTGTTTATATTGCGAATTTGAAGAAACCCAAATCGAGATACAGCTCTTTCCCACCAATTATGGCTGTCAAATCGGCTGAGGTCTCTGTTTCGTCTTCAATTCAAAAAGAGAAAGAGGTTTTGAATAATCTCAGAGGCTGTCGTAATGTGATCAGATGTTTTGGGGAAGAGATTACAACCGGAGAGAATGGACATATGGTGTACAATTTGCTGCT...

CDS

Download CDS FASTA

1086 bp · TkA03G411860|TK1151|CDS

ATGGTCTGGTTTAGAGGTTGTTTGATCGGTAAAGGGTGTTTTGGGTCTGTTTATATTGCGAATTTGAAGAAACCCAAATCGAGATACAGCTCTTTCCCACCAATTATGGCTGTCAAATCGGCTGAGGTCTCTGTTTCGTCTTCAATTCAAAAAGAGAAAGAGGTTTTGAATAATCTCAGAGGCTGTCGTAATGTGATCAGATGTTTTGGGGAAGAGATTACAACCGGAGAGAATGGACATATGGTGTACAATTTGCTGCT...

Protein

Download Protein FASTA

361 aa · TkA03G411860|TK1151|PROTEIN

MVWFRGCLIGKGCFGSVYIANLKKPKSRYSSFPPIMAVKSAEVSVSSSIQKEKEVLNNLRGCRNVIRCFGEEITTGENGHMVYNLLLEYGSGGTLADLINKSGRNGLPESDVKRHTRSILHGLRHIHNNGYVHCDLKPENILLVGTSSNRRFTAKIGDLGLAKRAKQSKKNKVVLFQRGTPMYFSPEVLIDGVQEAPSDIWAFGCIVSEMFTGKPSWNSKLENKNDEPPSIPSSISREARSFLKGCFSRKACFRWTAEML...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G411860`
TK1151 ID	TkA03G411860
OH-1004 ID	LXL04_009230
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.000
Protein coverage (%)	TK1151 100.000 / OH-1004 89.183 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G411860

Location Chr03:102432157-102433272 (+)

Description Similar to MAPKKK20: Mitogen-activated protein kinase kinase kinase 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50310`	Mitogen-activated protein kinase kinase (MAPKK) that phosphorylates both MKK3 and MPK18 and regulate two separate signaling pathways involved in root microtubule functions.	Arabidopsis MKKK20 is involved in osmotic stress response via regulation of MPK6 activity.2012 · DOI: 10.1007/s00299-011-1157-0 AIK1, A Mitogen-Activated Protein Kinase, Modulates Abscisic Acid Responses through the MKK5-MPK6 Kinase Cascade.2017 · DOI: 10.1104/pp.16.01386 The Arabidopsis Mitogen-Activated Protein Kinase Kinase Kinase 20 (MKKK20) Acts Upstream of MKK3 and MPK18 in Two Separate Signaling Pathways Involved in Root Microtubule Functions.2017 · DOI: 10.3389/fpls.2017.01352
`At5g66850`	Mitogen-activated protein kinase (MAPK) involved in the transduction of signal between the host cell surface chitin receptor complex CERK1-LYK5 and the intracellular MAPK cascade that leads to chitin-induced immunity.	The Arabidopsis CERK1-associated kinase PBL27 connects chitin perception to MAPK activation.2016 · DOI: 10.15252/embj.201694248

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009230 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0007165 signal transduction Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010029 regulation of seed germination Biological Process

KEGG gene cross-reference

ath:AT1G05100

ath:AT1G09000

ath:AT2G32510

ath:AT3G06030

ath:AT3G50310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.795

Rank 1 · TkA03G411860 · TK1151

Cytoplasm0.262

Rank 2 · TkA03G411860 · TK1151

Cell membrane0.059

Rank 3 · TkA03G411860 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA03G411860 · TK1151

Plastid0.028

Rank 5 · TkA03G411860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase8-266 aa

PF07714PK_Tyr_Ser-Thr8-257 aa

PF01636APH44-128 aa

PF17667Pkinase_fungal48-73 aa

PF03109ABC185-173 aa

PF17667Pkinase_fungal120-189 aa

PF01636APH130-144 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G411860	`PF00069`	Pkinase	8	266	1.7e-45	156.2
TkA03G411860	`PF07714`	PK_Tyr_Ser-Thr	8	257	3.7e-25	89.4
TkA03G411860	`PF01636`	APH	44	128	0.11	13.0
TkA03G411860	`PF17667`	Pkinase_fungal	48	73	0.0075	15.8
TkA03G411860	`PF03109`	ABC1	85	173	0.0026	17.6
TkA03G411860	`PF17667`	Pkinase_fungal	120	189	0.0075	15.8
TkA03G411860	`PF01636`	APH	130	144	0.11	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SND6`	Arabidopsis thaliana	sp\|Q9SND6\|M3K20_ARATH Mitogen-activated protein kinase kinase kinase 20	44.600%	Swiss-Prot	Medium
`Q9C5H5`	Arabidopsis thaliana	sp\|Q9C5H5\|M3K5G_ARATH Mitogen-activated protein kinase kinase kinase 5	34.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card