TkA03G408710 | RubberDandelionOmics

Gene overview

TkA03G408710

Reference: TK1151 Chr: Chr03 Coordinates: 101587564-101591017 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1244 bp · TkA03G408710|TK1151|cDNA

AAAGAAGTAGATTTACAGGATTTTGAGTGGGTTTCCATGAGTTTCCAATACAAATATTAAAACACATAGAAGCAAGACCAAACACAAGATATCCTAAACACAAGATTTACCTTCCCTTCTATTGTCTCTCCACAACTGTTGCTTCATGTTCCTAAAAGATTCTTGAAAACTGTTAGCAGATTATGGGAATGAACTTCCCTTTGAAGAATTGGATGATTCCCTTTTGGGTTTTGTCCTCTTTAATCGTAGTTTTAGAACCA...

CDS

Download CDS FASTA

1344 bp · TkA03G408710|TK1151|CDS

ATGGGAATGAACTTCCCTTTGAAGAATTGGATGATTCCCTTTTGGGTTTTGTCCTCTTTAATCGTAGTTTTAGAACCAATTGAGGCTATCAGGACAGACCCTCCTCTTTCCTCCATTGCTGATCCTGTTCTTCCCACCGAGAAAAAACCTCCATTTTCTCGCATACCCACGGAAAATGAAGCTCACTCTCCTGGAGTGTCAGAAATCACAGTCGTTCACCATGAGGATTTGAACACGAAGATTCTCGTCGCACTCATCAT...

Protein

Download Protein FASTA

447 aa · TkA03G408710|TK1151|PROTEIN

MGMNFPLKNWMIPFWVLSSLIVVLEPIEAIRTDPPLSSIADPVLPTEKKPPFSRIPTENEAHSPGVSEITVVHHEDLNTKILVALIIASTLLAALLLFLFCFWIFKQKNTEPLNTKKTPKSQDLSKGLSLGPILDKFTPTRITGRKGSVTVIDYEWLLSSTNHFHEDNIVRVDTSGHIYKARFNDHFTAAVKKLHGRGPDIQRGFENAVDWLGKLKHQNIINLLGYCVHDDTRFLVYEMMHQGSLESQLHGPSHGSALTW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G408710`
TK1151 ID	TkA03G408710
OH-1004 ID	LXL04_009203
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 91.499 / OH-1004 90.487 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G408710

Location Chr03:101587564-101591017 (+)

Description Similar to At1g80640: Probable receptor-like protein kinase At1g80640

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80640`	Probable receptor-like protein kinase At1g80640.	No verified direct reference in this release
`At3g24790`	May be involved in plant defense signaling.	No verified direct reference in this release
`At3g20530`	May be involved in plant defense signaling.	No verified direct reference in this release
`At5g13160`	Protein kinase required for plant defense mechanism mediated by the disease resistance (R) protein RPS5.	The Arabidopsis PBS1 resistance gene encodes a member of a novel protein kinase subfamily.2001 · DOI: 10.1046/j.1365-313x.2001.01014.x Cleavage of Arabidopsis PBS1 by a bacterial type III effector.2003 · DOI: 10.1126/science.1085671 Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease.2007 · DOI: 10.1073/pnas.0608779104 Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector.2010 · DOI: 10.1016/j.chom.2010.03.007 Activation of a plant nucleotide binding-leucine rich repeat disease resistance protein by a modified self protein.2012 · DOI: 10.1111/j.1462-5822.2012.01779.x
`At4g39400`	Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.	Brassinosteroid-insensitive dwarf mutants of Arabidopsis accumulate brassinosteroids.1999 · DOI: 10.1104/pp.121.3.743 Brassinosteroid-insensitive-1 is a ubiquitously expressed leucine-rich repeat receptor serine/threonine kinase.2000 · DOI: 10.1104/pp.123.4.1247 The Arabidopsis transthyretin-like protein is a potential substrate of BRASSINOSTEROID-INSENSITIVE 1.2004 · DOI: 10.1105/tpc.104.023903 The Arabidopsis thaliana brassinosteroid receptor (AtBRI1) contains a domain that functions as a guanylyl cyclase in vitro.2007 · DOI: 10.1371/journal.pone.0000449 BSKs mediate signal transduction from the receptor kinase BRI1 in Arabidopsis.2008 · DOI: 10.1126/science.1156973 Tyrosine phosphorylation of the BRI1 receptor kinase emerges as a component of brassinosteroid signaling in Arabidopsis.2009 · DOI: 10.1073/pnas.0810249106 BSKs are partially redundant positive regulators of brassinosteroid signaling in Arabidopsis.2013 · DOI: 10.1111/tpj.12175

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0372100`	Functions as an immediate downstream signaling partner of CERK1 in the microbial peptidoglycans (PGNs) and fungal chitin signaling pathways that mediate innate immunity.	A receptor-like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice immunity.2013 · DOI: 10.1016/j.chom.2013.02.007

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009203 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002758 innate immune response-activating signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0031349 positive regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0045088 regulation of innate immune response Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G80640

ath:AT3G20530

ath:AT3G24790

dosa:Os05g0372100

osa:4338592

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.862

Rank 1 · TkA03G408710 · TK1151

Cytoplasm0.086

Rank 2 · TkA03G408710 · TK1151

Endoplasmic reticulum0.080

Rank 3 · TkA03G408710 · TK1151

Nucleus0.063

Rank 4 · TkA03G408710 · TK1151

Golgi apparatus0.021

Rank 5 · TkA03G408710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04689S1FA40-66 aa

PF04689S1FA77-122 aa

PF00069Pkinase175-382 aa

PF07714PK_Tyr_Ser-Thr176-375 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G408710	`PF04689`	S1FA	40	66	0.07	14.0
TkA03G408710	`PF04689`	S1FA	77	122	0.07	14.0
TkA03G408710	`PF00069`	Pkinase	175	382	4.3e-37	128.7
TkA03G408710	`PF07714`	PK_Tyr_Ser-Thr	176	375	7.5e-41	140.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0V7T5`	Arabidopsis thaliana	sp\|Q0V7T5\|Y1864_ARATH Probable receptor-like protein kinase At1g80640	52.400%	Swiss-Prot	High
`Q9LRY1`	Arabidopsis thaliana	sp\|Q9LRY1\|PBL25_ARATH Probable serine/threonine-protein kinase PBL25	44.300%	Swiss-Prot	Medium
`F4JEQ2`	Arabidopsis thaliana	sp\|F4JEQ2\|PBL23_ARATH Probable serine/threonine-protein kinase PBL23	44.100%	Swiss-Prot	Medium
`Q9FE20`	Arabidopsis thaliana	sp\|Q9FE20\|PBS1_ARATH Serine/threonine-protein kinase PBS1	44.800%	Swiss-Prot	Medium
`O22476`	Arabidopsis thaliana	sp\|O22476\|BRI1_ARATH Protein BRASSINOSTEROID INSENSITIVE 1	44.500%	Swiss-Prot	Medium
`Q6I5Q6`	Oryza sativa subsp. japonica	sp\|Q6I5Q6\|RK185_ORYSJ Receptor-like cytoplasmic kinase 185	41.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card