TkA03G390690 | RubberDandelionOmics

Gene overview

TkA03G390690

Reference: TK1151 Chr: Chr03 Coordinates: 96849063-96853545 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2498 bp · TkA03G390690|TK1151|cDNA

CGACGCCACACCAGACGATTATTAACAAAACCTACGTCGGTCCTGATCCTAAAATCAGCAGCGGAGAAATCACACAAACCCAAAAGACAAGACCTTTAACTATTCGCTGGAATTGGGGTCTCAGTTTCGATACTTTCCTTTTCAAAACCTCATTCAATTGGAATCGTTGATCGCGGAGTAAGCAGTACGGTGGCCGTAGGCGGTAGGTCCCCAAACATCACGATCTTCCCTTTCTCTCGCCCACATCTTAAAAGATATAT...

CDS

Download CDS FASTA

1725 bp · TkA03G390690|TK1151|CDS

ATGAATCTGCAACAAGCTGCACCACCAAGGTCCTCTTCAAACGGATTCAACCGAAGGAAAGGTGAAAAAGAAATGGGGATTAGATTTGATAATAAATCTCAAAGTGGCAAGTCAATCTTCAACAAAACAGGTTTACCAACTGGAAACAAAGGAGGTGTTGACAGCCCATCACGTGAGAGACTTGTTTACTTAACAACATGTCTGATTGGACACCAGGTGGAAGTCCAGGTCACAGATGGATCTGTATACTCCGGGATATT...

Protein

Download Protein FASTA

574 aa · TkA03G390690|TK1151|PROTEIN

MNLQQAAPPRSSSNGFNRRKGEKEMGIRFDNKSQSGKSIFNKTGLPTGNKGGVDSPSRERLVYLTTCLIGHQVEVQVTDGSVYSGIFHATNAENDFGLILKMAFVTNTGSSQGQKTISDSANKAPSKTLIIPAKDLVQIVAKGVPVTKDVLTNEVQVEKQQDIMTDSLISRSRHVDLERELEPWVPDDDNIEIPELDNTFDRHWNRGWDQFETNAALFGVKSTFNEELYTTKLDRGPQMRELERQALRIAREIEGEDTQD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G390690`
TK1151 ID	TkA03G390690
OH-1004 ID	LXL04_008243
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G390690

Location Chr03:96849063-96853545 (-)

Description Similar to CID4: Polyadenylate-binding protein-interacting protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54170`	Polyadenylate-binding protein-interacting protein 3.	No verified direct reference in this release
`At3g14010`	Polyadenylate-binding protein-interacting protein 4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008243 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0016071 mRNA metabolic process Biological Process

GO:0034063 stress granule assembly Biological Process

GO:0042149 cellular response to glucose starvation Biological Process

GO:0043007 maintenance of rDNA Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:1901524 regulation of mitophagy Biological Process

GO:1904262 negative regulation of TORC1 signaling Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G54170

ath:AT3G14010

ddi:DDB_G0269682

sce:YGR178C

spo:2540677

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.752

Rank 1 · TkA03G390690 · TK1151

Nucleus0.233

Rank 2 · TkA03G390690 · TK1151

Cell membrane0.088

Rank 3 · TkA03G390690 · TK1151

Golgi apparatus0.080

Rank 4 · TkA03G390690 · TK1151

Lysosome / Vacuole0.054

Rank 5 · TkA03G390690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14438SM-ATX58-142 aa

PF06741LsmAD169-181 aa

PF06741LsmAD218-288 aa

PF07145PAM2351-356 aa

PF07145PAM2463-474 aa

PF07145PAM2476-485 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G390690	`PF14438`	SM-ATX	58	142	2.9e-26	92.2
TkA03G390690	`PF06741`	LsmAD	169	181	4e-26	92.0
TkA03G390690	`PF06741`	LsmAD	218	288	4e-26	92.0
TkA03G390690	`PF07145`	PAM2	351	356	2.4e-07	30.7
TkA03G390690	`PF07145`	PAM2	463	474	2.4e-07	30.7
TkA03G390690	`PF07145`	PAM2	476	485	2.4e-07	30.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L793`	Arabidopsis thaliana	sp\|Q8L793\|CID3_ARATH Polyadenylate-binding protein-interacting protein 3	42.300%	Swiss-Prot	Medium
`Q94AM9`	Arabidopsis thaliana	sp\|Q94AM9\|CID4_ARATH Polyadenylate-binding protein-interacting protein 4	40.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card