TkA03G387760 | RubberDandelionOmics

Gene overview

TkA03G387760

Reference: TK1151 Chr: Chr03 Coordinates: 95970626-95976368 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2939 bp · TkA03G387760|TK1151|cDNA

ATCGAATGTCCCCACACACTCTCTCTTACTTTCTCTATCATTAATTCATCACTCATGGTACGACTCCTATTCCACTAGTAAACCCATGATCCCATTATTGCTTTACCGAAATGAGGGTGCGAATGTTCTTGATCTCACCTGATTATCAGAGCAAAATCCCTTTTAGTTTTAGATGTCAAAAGACATCACCATTCCATTAATAGCAAGTACTATTTATAAGTTCTGCAAAACTTTGAGCTTTACTTCTTCGAGTAAGCAAA...

CDS

Download CDS FASTA

2367 bp · TkA03G387760|TK1151|CDS

ATGAATGTCATGTTGTTCATGGGGTTCCAAGTGATTATCAGGTTGATCACATTCTTGATTTTGTTTGTCGGTGGTGATTCTTTGGGTACTAGATCTGCAGATCATGGTGTTCCACCTGCATCAAGTCCAACCAACACCAAGCATCATGCAACGAAATGGATGAAACACGGTTTTAGACCTTTTTCTAGCACCTCTTTCGAGAGATATCATCATGAAAGATCGAAATTTAACCATATTGCTCCTACACCCTTGTACCAACT...

Protein

Download Protein FASTA

788 aa · TkA03G387760|TK1151|PROTEIN

MNVMLFMGFQVIIRLITFLILFVGGDSLGTRSADHGVPPASSPTNTKHHATKWMKHGFRPFSSTSFERYHHERSKFNHIAPTPLYQLQPPTYLPQGPSAPSPSPVDPTNRFGPMISPSKNTAPPPTPIFVLPPPPPNEDCTTVTCTQPLTYTPAGLPCACVWAIEVRLRLRISPFAFFPLVAELAKEIATSVSLNVSQARIMGANAAAEQLDKTIVLVNLVPLSENFDPATAFSIYQKFWKKQVSINRARFGAYEVVSVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G387760`
TK1151 ID	TkA03G387760
OH-1004 ID	LXL04_008298
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 93.476 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G387760

Location Chr03:95970626-95976368 (-)

Description Similar to ALE2: Receptor-like serine/threonine-protein kinase ALE2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20300`	Required during the differentiation of the protoderm into shoots epidermis and cuticle.	Novel receptor-like kinase ALE2 controls shoot development by specifying epidermis in Arabidopsis.2007 · DOI: 10.1242/dev.003533
`At1g68690`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390
`At5g13160`	Protein kinase required for plant defense mechanism mediated by the disease resistance (R) protein RPS5.	The Arabidopsis PBS1 resistance gene encodes a member of a novel protein kinase subfamily.2001 · DOI: 10.1046/j.1365-313x.2001.01014.x Cleavage of Arabidopsis PBS1 by a bacterial type III effector.2003 · DOI: 10.1126/science.1085671 Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease.2007 · DOI: 10.1073/pnas.0608779104 Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector.2010 · DOI: 10.1016/j.chom.2010.03.007 Activation of a plant nucleotide binding-leucine rich repeat disease resistance protein by a modified self protein.2012 · DOI: 10.1111/j.1462-5822.2012.01779.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0372100`	Functions as an immediate downstream signaling partner of CERK1 in the microbial peptidoglycans (PGNs) and fungal chitin signaling pathways that mediate innate immunity.	A receptor-like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice immunity.2013 · DOI: 10.1016/j.chom.2013.02.007

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008298 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002221 pattern recognition receptor signaling pathway Biological Process

GO:0002758 innate immune response-activating signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0010068 protoderm histogenesis Biological Process

GO:0030154 cell differentiation Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045087 innate immune response Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0090558 plant epidermis development Biological Process

GO:1905393 plant organ formation Biological Process

KEGG gene cross-reference

ath:AT1G68690

ath:AT2G20300

ath:AT5G13160

ath:AT5G38560

dosa:Os05g0372100

osa:4338592

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.848

Rank 1 · TkA03G387760 · TK1151

Cytoplasm0.087

Rank 2 · TkA03G387760 · TK1151

Endoplasmic reticulum0.082

Rank 3 · TkA03G387760 · TK1151

Nucleus0.074

Rank 4 · TkA03G387760 · TK1151

Golgi apparatus0.023

Rank 5 · TkA03G387760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23180ALE2_N146-265 aa

PF00069Pkinase409-609 aa

PF07714PK_Tyr_Ser-Thr410-679 aa

PF03109ABC1413-461 aa

PF01636APH436-486 aa

PF01636APH518-555 aa

PF03109ABC1520-557 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G387760	`PF23180`	ALE2_N	146	265	1.4e-50	171.1
TkA03G387760	`PF00069`	Pkinase	409	609	1.3e-44	153.3
TkA03G387760	`PF07714`	PK_Tyr_Ser-Thr	410	679	2.4e-48	165.4
TkA03G387760	`PF03109`	ABC1	413	461	0.00042	20.3
TkA03G387760	`PF01636`	APH	436	486	0.00089	19.8
TkA03G387760	`PF01636`	APH	518	555	0.00089	19.8
TkA03G387760	`PF03109`	ABC1	520	557	0.00042	20.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWW0`	Arabidopsis thaliana	sp\|Q8RWW0\|ALE2_ARATH Receptor-like serine/threonine-protein kinase ALE2	57.400%	Swiss-Prot	Medium
`Q9SX31`	Arabidopsis thaliana	sp\|Q9SX31\|PERK9_ARATH Proline-rich receptor-like protein kinase PERK9	53.900%	Swiss-Prot	Low
`Q9FFW5`	Arabidopsis thaliana	sp\|Q9FFW5\|PERK8_ARATH Proline-rich receptor-like protein kinase PERK8	51.800%	Swiss-Prot	Low
`Q9FE20`	Arabidopsis thaliana	sp\|Q9FE20\|PBS1_ARATH Serine/threonine-protein kinase PBS1	51.800%	Swiss-Prot	Low
`Q6I5Q6`	Oryza sativa subsp. japonica	sp\|Q6I5Q6\|RK185_ORYSJ Receptor-like cytoplasmic kinase 185	52.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card