LXL04_008298 | RubberDandelionOmics

Gene overview

LXL04_008298

Reference: OH-1004 Chr: Chr02 Coordinates: 96048207-96053600 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2532 bp · LXL04_008298|LXL04_008298|OH1004|cDNA

ATGTCAAAAGACATCACCATTCCATTAATAGCAAGTACTATTTATAAGTTCTGCAAAACTTTGAGCTTTACTTCTTCGAGTAAGCAAATCTGGCTTTTCCACCCCTACTTcttggaagaagaagaagaagctaTGGGTGGTACTGCACAAATTGAAGCCTTTTTCATGAATGTCATGTTGTTCATGGGGTTCCAAGTGATTATCAGGTTGATCACATTCTTGATTTTGTTTGTCGGTGGTGATTCTTTGGGTATTAGATC...

CDS

Download CDS FASTA

2532 bp · LXL04_008298|LXL04_008298|OH1004|CDS

ATGTCAAAAGACATCACCATTCCATTAATAGCAAGTACTATTTATAAGTTCTGCAAAACTTTGAGCTTTACTTCTTCGAGTAAGCAAATCTGGCTTTTCCACCCCTACTTCTTGGAAGAAGAAGAAGAAGCTATGGGTGGTACTGCACAAATTGAAGCCTTTTTCATGAATGTCATGTTGTTCATGGGGTTCCAAGTGATTATCAGGTTGATCACATTCTTGATTTTGTTTGTCGGTGGTGATTCTTTGGGTATTAGATC...

Protein

Download Protein FASTA

843 aa · LXL04_008298|LXL04_008298|OH1004|PROTEIN

MSKDITIPLIASTIYKFCKTLSFTSSSKQIWLFHPYFLEEEEEAMGGTAQIEAFFMNVMLFMGFQVIIRLITFLILFVGGDSLGIRSADHGVPPASSPTNTKHHATKWMKHGFRPFSSTSFERYHHERSKFNHIAPTPLYQLQPPTYLPQGPSAPSPSPVDPTNRFGPMISPSKNTAPPPTPIFVLPPPPPNEDCTTVTCTQPLTYTPAGLPCACVWAIEVRLRLRISPFAFFPLVAELAKEIATSVSLNVSQARIMGAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008298`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008298

Location Chr02:96048207-96053600 (+)

Description Similar to ALE2: Receptor-like serine/threonine-protein kinase ALE2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20300`	Required during the differentiation of the protoderm into shoots epidermis and cuticle.	Novel receptor-like kinase ALE2 controls shoot development by specifying epidermis in Arabidopsis.2007 · DOI: 10.1242/dev.003533
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390
`At1g68690`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At5g13160`	Protein kinase required for plant defense mechanism mediated by the disease resistance (R) protein RPS5.	The Arabidopsis PBS1 resistance gene encodes a member of a novel protein kinase subfamily.2001 · DOI: 10.1046/j.1365-313x.2001.01014.x Cleavage of Arabidopsis PBS1 by a bacterial type III effector.2003 · DOI: 10.1126/science.1085671 Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease.2007 · DOI: 10.1073/pnas.0608779104 Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector.2010 · DOI: 10.1016/j.chom.2010.03.007 Activation of a plant nucleotide binding-leucine rich repeat disease resistance protein by a modified self protein.2012 · DOI: 10.1111/j.1462-5822.2012.01779.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0372100`	Functions as an immediate downstream signaling partner of CERK1 in the microbial peptidoglycans (PGNs) and fungal chitin signaling pathways that mediate innate immunity.	A receptor-like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice immunity.2013 · DOI: 10.1016/j.chom.2013.02.007

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008298 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002221 pattern recognition receptor signaling pathway Biological Process

GO:0002758 innate immune response-activating signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0010068 protoderm histogenesis Biological Process

GO:0030154 cell differentiation Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045087 innate immune response Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0090558 plant epidermis development Biological Process

GO:1905393 plant organ formation Biological Process

KEGG gene cross-reference

ath:AT1G68690

ath:AT2G20300

ath:AT5G13160

ath:AT5G38560

dosa:Os05g0372100

osa:4338592

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.832

Rank 1 · LXL04_008298 · OH-1004

Cytoplasm0.094

Rank 2 · LXL04_008298 · OH-1004

Nucleus0.087

Rank 3 · LXL04_008298 · OH-1004

Endoplasmic reticulum0.084

Rank 4 · LXL04_008298 · OH-1004

Golgi apparatus0.024

Rank 5 · LXL04_008298 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23180.2ALE2_N201-320 aa

PF00069.32Pkinase464-664 aa

PF07714.24PK_Tyr_Ser-Thr465-734 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008298	`PF23180.2`	ALE2_N	201	320	1.6e-50	171.0
LXL04_008298	`PF00069.32`	Pkinase	464	664	6.8e-44	150.9
LXL04_008298	`PF07714.24`	PK_Tyr_Ser-Thr	465	734	3.4e-47	161.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWW0`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase ALE2	48.690%	Swiss-Prot	moderate database homology
`Q9FFW5`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK8	44.416%	Swiss-Prot	weak database homology
`Q9SX31`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK9	44.133%	Swiss-Prot	weak database homology
`Q9FE20`	Arabidopsis thaliana	Serine/threonine-protein kinase PBS1	48.837%	Swiss-Prot	weak database homology
`Q6I5Q6`	Oryza sativa subsp. japonica	Receptor-like cytoplasmic kinase 185	53.020%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card