TkA03G380620 | RubberDandelionOmics

Gene overview

TkA03G380620

Reference: TK1151 Chr: Chr03 Coordinates: 93884844-93887685 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

561 bp · TkA03G380620|TK1151|cDNA

ATGCTCAGAAAACAATACCGCCGGGACTGTGATGATCTTATTGCCGCCGAAGCCTATGAGTATACCAAAGGCCTCAATCTCACCGGAGACGGGAAGGACGTTTGGGTGTTCGACATTGATGAAACTACGCTATGTAATCTCCCATATTACGCTCGCGACACTGTTGCTTTCGGGGCAATACCGTTTAACTCGACGTCGTTTGACGCTTGGGTGGAGAAAGCAACGGCGCCAGCGGTACCAGGGTCTCTTAAACTGTACCA...

CDS

Download CDS FASTA

561 bp · TkA03G380620|TK1151|CDS

ATGCTCAGAAAACAATACCGCCGGGACTGTGATGATCTTATTGCCGCCGAAGCCTATGAGTATACCAAAGGCCTCAATCTCACCGGAGACGGGAAGGACGTTTGGGTGTTCGACATTGATGAAACTACGCTATGTAATCTCCCATATTACGCTCGCGACACTGTTGCTTTCGGGGCAATACCGTTTAACTCGACGTCGTTTGACGCTTGGGTGGAGAAAGCAACGGCGCCAGCGGTACCAGGGTCTCTTAAACTGTACCA...

Protein

Download Protein FASTA

186 aa · TkA03G380620|TK1151|PROTEIN

MLRKQYRRDCDDLIAAEAYEYTKGLNLTGDGKDVWVFDIDETTLCNLPYYARDTVAFGAIPFNSTSFDAWVEKATAPAVPGSLKLYQKLVKLGFKIVFLTGSHDIYREARMKNLKAVGYDKWEKLILKGAGEGSGVAYKSKKRKEVEEAGYRIRVRGNMGDQWSDLLGSNAGDRTFKVPDPTYYIG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G380620`
TK1151 ID	TkA03G380620
OH-1004 ID	LXL04_002476
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	49.500
Protein coverage (%)	TK1151 97.849 / OH-1004 50.140 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G380620

Location Chr03:93884844-93887685 (-)

Description Similar to APS1: Acid phosphatase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24770`	May function as somatic storage protein during early seedling development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002476 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003993 acid phosphatase activity Molecular Function

GO:0045735 nutrient reservoir activity Molecular Function

KEGG gene cross-reference

ath:AT5G24780

gmx:547820

gmx:547821

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.625

Rank 1 · TkA03G380620 · TK1151

Cytoplasm0.134

Rank 2 · TkA03G380620 · TK1151

Lysosome / Vacuole0.101

Rank 3 · TkA03G380620 · TK1151

Endoplasmic reticulum0.071

Rank 4 · TkA03G380620 · TK1151

Nucleus0.036

Rank 5 · TkA03G380620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03767Acid_phosphat_B3-185 aa

PF12710HAD36-54 aa

PF12710HAD62-153 aa

PF24694LNS2_PITM1-376-126 aa

PF13344Hydrolase_678-127 aa

PF30655DUF8691151-167 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G380620	`PF03767`	Acid_phosphat_B	3	185	1.1e-58	199.2
TkA03G380620	`PF12710`	HAD	36	54	0.12	13.4
TkA03G380620	`PF12710`	HAD	62	153	0.12	13.4
TkA03G380620	`PF24694`	LNS2_PITM1-3	76	126	0.23	12.2
TkA03G380620	`PF13344`	Hydrolase_6	78	127	0.16	12.7
TkA03G380620	`PF30655`	DUF8691	151	167	0.24	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82122`	Arabidopsis thaliana	sp\|O82122\|VSP2_ARATH Vegetative storage protein 2	39.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card