TkA03G368760 | RubberDandelionOmics

Gene overview

TkA03G368760

Reference: TK1151 Chr: Chr03 Coordinates: 90958828-90964277 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2151 bp · TkA03G368760|TK1151|cDNA

ATGGCCTGGTTGCGCGGGAAGGTCGCGATAGGGAGCTTCCCGGATTTAGCTGGAGCCGTTAACAAGATAAGCGAGAGCGTCAAGAACATTGAGAAGAATTTTGACAATGCTCTTGGTTTAGAAGACCAGCCTGAGGCAGAATCTTCAAGTCATGGCAATCTCACTGTAAACTCTTCCAAAAAACCTGAACCTTCAGAAATCTATCAATCTACAGAAAAACAAGAATCTTCAAAAGAAGCTGAATCTTCAGATAAACACGA...

CDS

Download CDS FASTA

2151 bp · TkA03G368760|TK1151|CDS

ATGGCCTGGTTGCGCGGGAAGGTCGCGATAGGGAGCTTCCCGGATTTAGCTGGAGCCGTTAACAAGATAAGCGAGAGCGTCAAGAACATTGAGAAGAATTTTGACAATGCTCTTGGTTTAGAAGACCAGCCTGAGGCAGAATCTTCAAGTCATGGCAATCTCACTGTAAACTCTTCCAAAAAACCTGAACCTTCAGAAATCTATCAATCTACAGAAAAACAAGAATCTTCAAAAGAAGCTGAATCTTCAGATAAACACGA...

Protein

Download Protein FASTA

716 aa · TkA03G368760|TK1151|PROTEIN

MAWLRGKVAIGSFPDLAGAVNKISESVKNIEKNFDNALGLEDQPEAESSSHGNLTVNSSKKPEPSEIYQSTEKQESSKEAESSDKHESSTDPSISKEKEGIDNINISPVRDANAEISNPEEHHVETLKPQEHEHQHHPEEVDNSGEKSMDTNYTVSCEQADGNVGIPKEPENIAKKPLETDTATSDKATAISDNHIEAETDSQPKPSTDDIEDSENSLNIRETETTQNSVVKEVDATYDGQSAVESEPHEVNEIVKEGQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G368760`
TK1151 ID	TkA03G368760
OH-1004 ID	LXL04_008469
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 48.603 / OH-1004 64.207 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G368760

Location Chr03:90958828-90964277 (+)

Description Similar to GC5: Golgin candidate 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79830`	Golgi matrix protein playing a role in tethering of vesicles to Golgi membranes and in maintaining the overall structure of the Golgi apparatus.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008469 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001675 acrosome assembly Biological Process

GO:0001819 positive regulation of cytokine production Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0007286 spermatid development Biological Process

GO:0007289 spermatid nucleus differentiation Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0030317 flagellated sperm motility Biological Process

GO:0030521 androgen receptor signaling pathway Biological Process

GO:0032275 luteinizing hormone secretion Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0061136 regulation of proteasomal protein catabolic process Biological Process

KEGG gene cross-reference

ath:AT1G79830

hsa:7110

mmu:232286

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.497

Rank 1 · TkA03G368760 · TK1151

Golgi apparatus0.478

Rank 2 · TkA03G368760 · TK1151

Endoplasmic reticulum0.139

Rank 3 · TkA03G368760 · TK1151

Nucleus0.106

Rank 4 · TkA03G368760 · TK1151

Cell membrane0.088

Rank 5 · TkA03G368760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12329TMF_DNA_bd76-84 aa

PF24423OVT1214-253 aa

PF24423OVT1295-314 aa

PF12329TMF_DNA_bd316-333 aa

PF12329TMF_DNA_bd344-354 aa

PF24423OVT1346-383 aa

PF24423OVT1352-438 aa

PF12329TMF_DNA_bd384-456 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G368760	`PF12329`	TMF_DNA_bd	76	84	3.3e-14	53.3
TkA03G368760	`PF24423`	OVT1	214	253	0.0033	18.5
TkA03G368760	`PF24423`	OVT1	295	314	0.0033	18.5
TkA03G368760	`PF12329`	TMF_DNA_bd	316	333	3.3e-14	53.3
TkA03G368760	`PF12329`	TMF_DNA_bd	344	354	3.3e-14	53.3
TkA03G368760	`PF24423`	OVT1	346	383	0.0033	18.5
TkA03G368760	`PF24423`	OVT1	352	438	0.0033	18.5
TkA03G368760	`PF12329`	TMF_DNA_bd	384	456	3.3e-14	53.3
TkA03G368760	`PF24423`	OVT1	420	473	0.0033	18.5
TkA03G368760	`PF12329`	TMF_DNA_bd	485	513	3.3e-14	53.3
TkA03G368760	`PF24423`	OVT1	501	569	0.0033	18.5
TkA03G368760	`PF12329`	TMF_DNA_bd	528	564	3.3e-14	53.3
TkA03G368760	`PF12329`	TMF_DNA_bd	599	618	3.3e-14	53.3
TkA03G368760	`PF24423`	OVT1	616	694	0.0033	18.5
TkA03G368760	`PF12329`	TMF_DNA_bd	635	696	3.3e-14	53.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WVL7`	Arabidopsis thaliana	sp\|Q0WVL7\|GOGC5_ARATH Golgin candidate 5	49.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card