RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G366950
Reference: TK1151 Chr: Chr03 Coordinates: 90518244-90525498 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3347 bp · TkA03G366950|TK1151|cDNA

AAATATGGCGGGAACATAAACAGAGAGTTTGGAGGAAATTTATCTAGGGTTTGCGAAAGGCCACTCAGTCAAAGAGCATTTCATCATCTGTTTTCTTTTTCGCACATACAAGCAGGTAGAGATGCCAACTTACAAGATCAGGGGAATCAATGTCGAATTCCCATTTGAGGCTTACGATTGCCAGCTCGTTTACATGGAAAAAGTCATCCAGTCTCTTCAAGACAGGTCAAACGCCCTACTGGAGAGTCCAACAGGAACCG...

CDS

Download CDS FASTA

2988 bp · TkA03G366950|TK1151|CDS

ATGCCAACTTACAAGATCAGGGGAATCAATGTCGAATTCCCATTTGAGGCTTACGATTGCCAGCTCGTTTACATGGAAAAAGTCATCCAGTCTCTTCAAGACAGGTCAAACGCCCTACTGGAGAGTCCAACAGGAACCGGCAAAACACTATGTCTTCTATGTGCAACTTTAGCGTGGAGAAAAAGTTTGGGTCCTTTCTCCAAAGGTAAGAATGCAATAAGAAGTCAGGACACAGGAGGCAAACACTCAGAAACACCATC...

Protein

Download Protein FASTA

995 aa · TkA03G366950|TK1151|PROTEIN

MPTYKIRGINVEFPFEAYDCQLVYMEKVIQSLQDRSNALLESPTGTGKTLCLLCATLAWRKSLGPFSKGKNAIRSQDTGGKHSETPSSQSDSSRLPTIIYTSRTHSQIRQVVQELKRTVYRPKMVVLGSREQLCIHPDVSLLYGKAQTNACHFLCQKRTKKYCAHFPRVTEFVKSNPGLGDEPIDIEDLVNIGKSSGPCPYYMSRELHKVVDILFAPYNYLIDPGNRKSLSIEWENSILIFDEAHNLEGICADAASFDLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G366950
TK1151 IDTkA03G366950
OH-1004 IDLXL04_008487
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.100
Protein coverage (%)TK1151 100.000 / OH-1004 92.386
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G366950
LocationChr03:90518244-90525498 (+)
DescriptionSimilar to RTEL1: Regulator of telomere elongation helicase 1 homolog
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g79950 A probable ATP-dependent DNA helicase implicated in DNA replication, DNA repair and the maintenance of genomic stability.
The Arabidopsis thaliana homolog of the helicase RTEL1 plays multiple roles in preserving genome stability.2014 · DOI: 10.1105/tpc.114.132472
Deficiency of the Arabidopsis helicase RTEL1 triggers a SOG1-dependent replication checkpoint in response to DNA cross-links.2015 · DOI: 10.1105/tpc.114.134312
The RTR Complex Partner RMI2 and the DNA Helicase RTEL1 Are Both Independently Involved in Preserving the Stability of 45S rDNA Repeats in Arabidopsis thaliana.2016 · DOI: 10.1371/journal.pgen.1006394

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0592900 A probable ATP-dependent DNA helicase implicated in DNA replication, DNA repair and the maintenance of genomic stability. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_008487 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000723 telomere maintenance Biological Process
GO:0000725 recombinational repair Biological Process
GO:0000732 DNA strand displacement Biological Process
GO:0006260 DNA replication Biological Process
GO:0006281 DNA repair Biological Process
GO:0006310 DNA recombination Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009555 pollen development Biological Process
GO:0010569 regulation of double-strand break repair via homologous recombination Biological Process
GO:0031297 replication fork processing Biological Process
GO:0032206 positive regulation of telomere maintenance Biological Process
GO:0036297 interstrand cross-link repair Biological Process
KEGG gene cross-reference
ath:AT1G79950
dosa:Os01g0592900
mmu:269400
rno:362288
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.714
Rank 1 · TkA03G366950 · TK1151
Cytoplasm0.290
Rank 2 · TkA03G366950 · TK1151
Mitochondrion0.068
Rank 3 · TkA03G366950 · TK1151
Cell membrane0.037
Rank 4 · TkA03G366950 · TK1151
Endoplasmic reticulum0.030
Rank 5 · TkA03G366950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851ResIII16-59 aa
PF00270DEAD26-121 aa
PF06733DEAD_2100-261 aa
PF00270DEAD205-248 aa
PF04851ResIII214-248 aa
PF23109ARCH_RTEL1266-428 aa
PF17016DUF5095361-402 aa
PF13307Helicase_C_2513-706 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G366950PF04851ResIII16593.5e-0524.5
TkA03G366950PF00270DEAD261214e-0627.4
TkA03G366950PF06733DEAD_21002615.4e-52176.6
TkA03G366950PF00270DEAD2052484e-0627.4
TkA03G366950PF04851ResIII2142483.5e-0524.5
TkA03G366950PF23109ARCH_RTEL12664281.6e-42146.2
TkA03G366950PF17016DUF50953614020.2111.9
TkA03G366950PF13307Helicase_C_25137066.3e-47160.5
TkA03G366950PF16545CCM2_C5735910.04414.6
TkA03G366950PF17016DUF50957427750.2111.9
TkA03G366950PF17016DUF50958118620.2111.9
TkA03G366950PF06733DEAD_28298615.4e-52176.6
TkA03G366950PF23116HHD_RTEL18659885.3e-1247.2
TkA03G366950PF16545CCM2_C9159870.04414.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4HQE2Arabidopsis thalianasp|F4HQE2|RTEL1_ARATH Regulator of telomere elongation helicase 1 homolog53.000%Swiss-ProtHigh
A0A0P0V4R0Oryza sativa subsp. japonicasp|A0A0P0V4R0|RTEL1_ORYSJ Regulator of telomere elongation helicase 1 homolog53.800%Swiss-ProtHigh

JBrowse

View in Genome Browser