LXL04_008487 | RubberDandelionOmics

Gene overview

LXL04_008487

Reference: OH-1004 Chr: Chr02 Coordinates: 101015669-101021201 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3234 bp · LXL04_008487|LXL04_008487|OH1004|cDNA

atgtacGGGTACCGGATCTCAGATTTTAggatttggaaccggaaccggtcTGATCAGATCCCAGATTTTAggatttggaaccggaaccggttggaccagttccagttccggaaCCGCCGGTTCCCACCAGATCCAGATCCAGATCCAGAGAGTTTGGAGGAAATTTATCTAGGGTTTGCGAAAGGCCACTCAGTCAAAGAGCATTTCATCATCTGTTTTCTTTTTCGCACATACAAGCAAGTAGAGATGCCAACTTACAA...

CDS

Download CDS FASTA

3234 bp · LXL04_008487|LXL04_008487|OH1004|CDS

ATGTACGGGTACCGGATCTCAGATTTTAGGATTTGGAACCGGAACCGGTCTGATCAGATCCCAGATTTTAGGATTTGGAACCGGAACCGGTTGGACCAGTTCCAGTTCCGGAACCGCCGGTTCCCACCAGATCCAGATCCAGATCCAGAGAGTTTGGAGGAAATTTATCTAGGGTTTGCGAAAGGCCACTCAGTCAAAGAGCATTTCATCATCTGTTTTCTTTTTCGCACATACAAGCAAGTAGAGATGCCAACTTACAA...

Protein

Download Protein FASTA

1077 aa · LXL04_008487|LXL04_008487|OH1004|PROTEIN

MYGYRISDFRIWNRNRSDQIPDFRIWNRNRLDQFQFRNRRFPPDPDPDPESLEEIYLGFAKGHSVKEHFIICFLFRTYKQVEMPTYKIRGINVEFPFEAYDCQLVYMEKVIQSLQDRSNALLESPTGTGKTLCLLCATLAWRKSLGPFSKGKNAIRSQDTGGKHSETPSSQSDSSRLPTIIYTSRTHSQIRQVVQELKRTVYRPKMVVLGSREQLCIHPDVSLLYGKAQTNACHFLCQKRTKKYCAHFPRVTEFVKSNPG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008487`
TK1151 ID	TkA03G366950
OH-1004 ID	LXL04_008487
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 92.386 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008487

Location Chr02:101015669-101021201 (-)

Description Similar to RTEL1: Regulator of telomere elongation helicase 1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79950`	A probable ATP-dependent DNA helicase implicated in DNA replication, DNA repair and the maintenance of genomic stability.	The Arabidopsis thaliana homolog of the helicase RTEL1 plays multiple roles in preserving genome stability.2014 · DOI: 10.1105/tpc.114.132472 Deficiency of the Arabidopsis helicase RTEL1 triggers a SOG1-dependent replication checkpoint in response to DNA cross-links.2015 · DOI: 10.1105/tpc.114.134312 The RTR Complex Partner RMI2 and the DNA Helicase RTEL1 Are Both Independently Involved in Preserving the Stability of 45S rDNA Repeats in Arabidopsis thaliana.2016 · DOI: 10.1371/journal.pgen.1006394

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0592900`	A probable ATP-dependent DNA helicase implicated in DNA replication, DNA repair and the maintenance of genomic stability.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008487 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0000725 recombinational repair Biological Process

GO:0000732 DNA strand displacement Biological Process

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009555 pollen development Biological Process

GO:0010569 regulation of double-strand break repair via homologous recombination Biological Process

GO:0031297 replication fork processing Biological Process

GO:0032206 positive regulation of telomere maintenance Biological Process

GO:0036297 interstrand cross-link repair Biological Process

KEGG gene cross-reference

ath:AT1G79950

dosa:Os01g0592900

mmu:269400

rno:362288

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.704

Rank 1 · LXL04_008487 · OH-1004

Cytoplasm0.288

Rank 2 · LXL04_008487 · OH-1004

Mitochondrion0.062

Rank 3 · LXL04_008487 · OH-1004

Cell membrane0.041

Rank 4 · LXL04_008487 · OH-1004

Endoplasmic reticulum0.033

Rank 5 · LXL04_008487 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD108-203 aa

PF06733.22DEAD_2182-343 aa

PF23109.2ARCH_RTEL1348-510 aa

PF13307.13Helicase_C_2595-788 aa

PF23116.3HHD_RTEL1930-1070 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008487	`PF00270.36`	DEAD	108	203	5e-06	27.1
LXL04_008487	`PF06733.22`	DEAD_2	182	343	4.4e-52	176.9
LXL04_008487	`PF23109.2`	ARCH_RTEL1	348	510	2e-42	146.0
LXL04_008487	`PF13307.13`	Helicase_C_2	595	788	7.1e-47	160.3
LXL04_008487	`PF23116.3`	HHD_RTEL1	930	1070	5.4e-12	47.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HQE2`	Arabidopsis thaliana	Regulator of telomere elongation helicase 1 homolog	52.970%	Swiss-Prot	strong database homology
`A0A0P0V4R0`	Oryza sativa subsp. japonica	Regulator of telomere elongation helicase 1 homolog	53.876%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card