TkA03G366920 | RubberDandelionOmics

Gene overview

TkA03G366920

Reference: TK1151 Chr: Chr03 Coordinates: 90511841-90514758 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2804 bp · TkA03G366920|TK1151|cDNA

CAGTATTGTATATTTGAAGCACGAGTATGATCAAGTTCTAACATTCATTGCTCAGAATAAAAATTAGACAAAATTAAGTTGTTATATGACTTATATCACAAAAGTTTATTAGAAATCGAATTATCGAAGTCAAAAGCACAAAAAAGAAACCTAAATCACCGCACCGTCTATTTTTTCTTTTGTAATCCCGCCACCGGCTACCATCCTCTGCACCACCGCCACCTCCCATCTCCTTCTCAAGAGTCCAAGACCCCACCCCC...

CDS

Download CDS FASTA

1923 bp · TkA03G366920|TK1151|CDS

ATGGGAAAGACGACGAACATGTCAATTGGTTTGCGACGGTCGATCTCCACTATTCCTTTTCTCTCCGACAGAATCAAGCAAACAGAAAGTGAAATTGTTCAAATGTTCCAGTTGTCGCGTCCAAGAGAAGATACAAGGAATCTACCCATCAATCAAAGAACATCAAGAAAGACCTCTGCACGGATGCTGGACGAGAGATTTATCAGGATTTTGAAGATATTCAAGTGGGGTCCTGATGCAGAAAAGGCTTTAGAAGTACT...

Protein

Download Protein FASTA

640 aa · TkA03G366920|TK1151|PROTEIN

MGKTTNMSIGLRRSISTIPFLSDRIKQTESEIVQMFQLSRPREDTRNLPINQRTSRKTSARMLDERFIRILKIFKWGPDAEKALEVLKLRVDHRLVREVLNIDVHVNVKIQFFKWAGKRRHFEHDSTTYMALISCLSDSEMFGEMWKTIQEMVRHSVIIEPKDLSDIVRLLGKAKMVNKALSLFYQVKGRKCNPTSSTYNSIILMLMQENHPDKVYDLYSEMCNEGNCFPDTITYSALMSAFAKLGQDNTAIRLFDEMKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G366920`
TK1151 ID	TkA03G366920
OH-1004 ID	LXL04_008488
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.100
Protein coverage (%)	TK1151 67.188 / OH-1004 66.978 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G366920

Location Chr03:90511841-90514758 (-)

Description Similar to At3g16010: Pentatricopeptide repeat-containing protein At3g16010

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16010`	Pentatricopeptide repeat-containing protein At3g16010.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008488 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0000963 mitochondrial RNA processing Biological Process

GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G06920

ath:AT3G16010

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.650

Rank 1 · TkA03G366920 · TK1151

Plastid0.220

Rank 2 · TkA03G366920 · TK1151

Nucleus0.073

Rank 3 · TkA03G366920 · TK1151

Cytoplasm0.028

Rank 4 · TkA03G366920 · TK1151

Cell membrane0.011

Rank 5 · TkA03G366920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13812PPR_3118-135 aa

PF23276TPR_24121-221 aa

PF25058ARM_TT21122-153 aa

PF29070MSC6_N123-147 aa

PF17177PPR_long123-251 aa

PF13041PPR_2125-157 aa

PF12854PPR_1125-136 aa

PF01535PPR128-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G366920	`PF13812`	PPR_3	118	135	5.3e-64	212.9
TkA03G366920	`PF23276`	TPR_24	121	221	5.4e-31	108.0
TkA03G366920	`PF25058`	ARM_TT21	122	153	5.2e-06	27.2
TkA03G366920	`PF29070`	MSC6_N	123	147	1.4e-36	127.1
TkA03G366920	`PF17177`	PPR_long	123	251	6.3e-30	104.8
TkA03G366920	`PF13041`	PPR_2	125	157	1.8e-115	377.7
TkA03G366920	`PF12854`	PPR_1	125	136	8.9e-85	278.8
TkA03G366920	`PF01535`	PPR	128	156	2.4e-85	275.7
TkA03G366920	`PF24760`	TPR_IF140_C	128	152	0.00018	22.6
TkA03G366920	`PF23248`	KH_PARP14_2	144	180	0.023	15.2
TkA03G366920	`PF13812`	PPR_3	151	205	5.3e-64	212.9
TkA03G366920	`PF28771`	RMD9_mid	154	188	0.0069	16.9
TkA03G366920	`PF00637`	Clathrin	159	215	0.14	12.6
TkA03G366920	`PF10366`	Vps39_1	160	203	0.0073	17.3
TkA03G366920	`PF13170`	DUF4003	164	224	0.032	14.5
TkA03G366920	`PF25569`	TPR_ZFYVE26	167	242	0.33	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LW84`	Arabidopsis thaliana	sp\|Q9LW84\|PP236_ARATH Pentatricopeptide repeat-containing protein At3g16010	73.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card