TkA03G358730 | RubberDandelionOmics

Gene overview

TkA03G358730

Reference: TK1151 Chr: Chr03 Coordinates: 88508389-88509899 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1200 bp · TkA03G358730|TK1151|cDNA

GACCAAAGAGATTGGGCCATTATCATTTAGGCCCAAAGTTCTGACTCAGTTATTCCTAAGCGAGAACGCAGTACTGAATGCCTGAATCAAGCAATGGAGGTAATACGACGGCTGTCGCAACATCTCCCGTCGAAACCAATCACCGGTAAATGCTTCAGGCTCATTAGTACCACCCCGTTACTTCACACTAGAACCCTAATTTTTCGATCCCAAAATAAACCCATTTTAAACCCTGCCATTAACGCGAACTTCATAACGAC...

CDS

Download CDS FASTA

810 bp · TkA03G358730|TK1151|CDS

ATGGAGGTAATACGACGGCTGTCGCAACATCTCCCGTCGAAACCAATCACCGGTAAATGCTTCAGGCTCATTAGTACCACCCCGTTACTTCACACTAGAACCCTAATTTTTCGATCCCAAAATAAACCCATTTTAAACCCTGCCATTAACGCGAACTTCATAACGACTAGTAGAGGTTTCAGTTCTCCTTCATCGACTTGGTTCGGCGGGTTGGTGAAGAAGAAGAAGGTTCTAGATTTGCCCTGTATTGTGAAAGCAGG...

Protein

Download Protein FASTA

269 aa · TkA03G358730|TK1151|PROTEIN

MEVIRRLSQHLPSKPITGKCFRLISTTPLLHTRTLIFRSQNKPILNPAINANFITTSRGFSSPSSTWFGGLVKKKKVLDLPCIVKAGDPVLHEPAREVSPEEIRSDRIQKIIDDMVQVMRRRPGVGLAAPQIGIPLKIIVLEDLKEYIAHEPEEENKAHDRRPFDLLVILNPKLRKKGNKSAFFYEGCLSVDGYRALVERFLEVEVRGLDRDGKPMKVDARGWQARILQHECDHLDGTLYVDKMVKRTFRTIENMDMPLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G358730`
TK1151 ID	TkA03G358730
OH-1004 ID	LXL04_002019
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	65.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G358730

Location Chr03:88508389-88509899 (+)

Description Similar to PDF1A: Peptide deformylase 1A, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g15390`	Removes the formyl group from the N-terminal Met of newly synthesized proteins.	Eukaryotic peptide deformylases. Nuclear-encoded and chloroplast-targeted enzymes in Arabidopsis.2001 · DOI: 10.1104/pp.127.1.97 Distinctive features of the two classes of eukaryotic peptide deformylases.2001 · DOI: 10.1006/jmbi.2001.5175

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0555800`	Removes the formyl group from the N-terminal Met of newly synthesized proteins.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002019 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0018206 peptidyl-methionine modification Biological Process

GO:0043687 post-translational protein modification Biological Process

GO:0051604 protein maturation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0042586 peptide deformylase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G15390

dosa:Os01g0555800

gvi:glr1729

mmu:68023

sly:544225

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.710

Rank 1 · TkA03G358730 · TK1151

Plastid0.326

Rank 2 · TkA03G358730 · TK1151

Nucleus0.042

Rank 3 · TkA03G358730 · TK1151

Cytoplasm0.042

Rank 4 · TkA03G358730 · TK1151

Cell membrane0.013

Rank 5 · TkA03G358730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01327Pep_deformylase83-247 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G358730	`PF01327`	Pep_deformylase	83	247	5e-47	160.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FV53`	Arabidopsis thaliana	sp\|Q9FV53\|DEF1A_ARATH Peptide deformylase 1A, chloroplastic/mitochondrial	60.600%	Swiss-Prot	High
`B6RGY0`	Oryza sativa subsp. japonica	sp\|B6RGY0\|DEF1A_ORYSJ Peptide deformylase 1A, chloroplastic	68.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card