TkA03G349970 | RubberDandelionOmics

Gene overview

TkA03G349970

Reference: TK1151 Chr: Chr03 Coordinates: 86166064-86167139 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

510 bp · TkA03G349970|TK1151|cDNA

ATGAGATTGAGACCTTGGTTAAGCGATGTGCGAGTTCTTCAGCAGCTGGATCAAGAAGCATTAATTTGTTCGAGAAGCTCGATAGGTCCATTTCAATACGAATTAGAAAATGGCGACGATGAATATGACGACTACTTACAGCAGCCTGAAAAGAAAAGACGCCTCAAGCCCGATCAAGTTCAGTTCCTCGAGAAAAGCTTCGAGACAGATAACAAACTCGAGCCCGACATAAAGATTCAGCTAGCAAAAGATCTCGGCTT...

CDS

Download CDS FASTA

510 bp · TkA03G349970|TK1151|CDS

ATGAGATTGAGACCTTGGTTAAGCGATGTGCGAGTTCTTCAGCAGCTGGATCAAGAAGCATTAATTTGTTCGAGAAGCTCGATAGGTCCATTTCAATACGAATTAGAAAATGGCGACGATGAATATGACGACTACTTACAGCAGCCTGAAAAGAAAAGACGCCTCAAGCCCGATCAAGTTCAGTTCCTCGAGAAAAGCTTCGAGACAGATAACAAACTCGAGCCCGACATAAAGATTCAGCTAGCAAAAGATCTCGGCTT...

Protein

Download Protein FASTA

169 aa · TkA03G349970|TK1151|PROTEIN

MRLRPWLSDVRVLQQLDQEALICSRSSIGPFQYELENGDDEYDDYLQQPEKKRRLKPDQVQFLEKSFETDNKLEPDIKIQLAKDLGLQPRQIAIWFQNRRARWEPTGTSIRCRVPRQRQSKPAVGRQAAASGGRMAASGGRTAVRGGGRQNQPRKAKNSPARATIATQS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G349970`
TK1151 ID	TkA03G349970
OH-1004 ID	LXL04_036868
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	95.100
Protein coverage (%)	TK1151 47.929 / OH-1004 44.505 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G349970

Location Chr03:86166064-86167139 (-)

Description Similar to HAT5: Homeobox-leucine zipper protein HAT5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01470`	Probable transcription activator involved in leaf development.	Ectopic expression of the Arabidopsis transcriptional activator Athb-1 alters leaf cell fate in tobacco.1995 · DOI: 10.1105/tpc.7.11.1773
`At1g69780`	Probable transcription factor that may act in the sucrose-signaling pathway.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0729700`	Probable transcription factor.	No verified direct reference in this release
`UniProt: A2X980`	Probable transcription factor.	No verified direct reference in this release
`UniProt: A2YWC0`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036868 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009637 response to blue light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009744 response to sucrose Biological Process

GO:0009965 leaf morphogenesis Biological Process

GO:0017148 negative regulation of translation Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048826 cotyledon morphogenesis Biological Process

GO:0080022 primary root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific Molecular Function

KEGG gene cross-reference

ath:AT1G69780

ath:AT3G01470

dosa:Os02g0729700

dosa:Os08g0481400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.961

Rank 1 · TkA03G349970 · TK1151

Cytoplasm0.122

Rank 2 · TkA03G349970 · TK1151

Cell membrane0.016

Rank 3 · TkA03G349970 · TK1151

Mitochondrion0.013

Rank 4 · TkA03G349970 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA03G349970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25317SAM_SMF11-18 aa

PF05985EutC12-82 aa

PF24133DUF740043-65 aa

PF00046Homeodomain51-103 aa

PF05920Homeobox_KN76-102 aa

PF25317SAM_SMF76-106 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G349970	`PF25317`	SAM_SMF	11	18	0.2	12.7
TkA03G349970	`PF05985`	EutC	12	82	0.14	12.2
TkA03G349970	`PF24133`	DUF7400	43	65	0.2	11.5
TkA03G349970	`PF00046`	Homeodomain	51	103	9.6e-17	61.3
TkA03G349970	`PF05920`	Homeobox_KN	76	102	0.0001	22.8
TkA03G349970	`PF25317`	SAM_SMF	76	106	0.2	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q02283`	Arabidopsis thaliana	sp\|Q02283\|HAT5_ARATH Homeobox-leucine zipper protein HAT5	75.900%	Swiss-Prot	Low
`Q8LC03`	Arabidopsis thaliana	sp\|Q8LC03\|ATB13_ARATH Homeobox-leucine zipper protein ATHB-13	68.100%	Swiss-Prot	Low
`Q6YWR4`	Oryza sativa subsp. japonica	sp\|Q6YWR4\|HOX16_ORYSJ Homeobox-leucine zipper protein HOX16	68.300%	Swiss-Prot	Low
`A2X980`	Oryza sativa subsp. indica	sp\|A2X980\|HOX16_ORYSI Homeobox-leucine zipper protein HOX16	68.300%	Swiss-Prot	Low
`A2YWC0`	Oryza sativa subsp. indica	sp\|A2YWC0\|HOX20_ORYSI Homeobox-leucine zipper protein HOX20	72.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card