TkA03G349020 | RubberDandelionOmics

Gene overview

TkA03G349020

Reference: TK1151 Chr: Chr03 Coordinates: 85891350-85892724 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

765 bp · TkA03G349020|TK1151|cDNA

ATGACCGGTAGAACTCGGCCCTTCTGCGATTTCGAGGACACAACGAGGCAAGGAGAACGCGAGGAAGAGAAGCCGACGAGAAGGAAATGGCGGCCTTGCCGGAAGTTAGACAGCGGCGGCGACAGTCTTTCCCCGATATTTTTGGACGAGGTTTATGCAACAACGAACAACTTAACAGGAATGCTAGTTGGGAGGTTTATAGTTGGAATCGGATTGGGTATTGGTCCTCCTGTAGCATCTCTCTATATCACAGAGGTTTC...

CDS

Download CDS FASTA

765 bp · TkA03G349020|TK1151|CDS

ATGACCGGTAGAACTCGGCCCTTCTGCGATTTCGAGGACACAACGAGGCAAGGAGAACGCGAGGAAGAGAAGCCGACGAGAAGGAAATGGCGGCCTTGCCGGAAGTTAGACAGCGGCGGCGACAGTCTTTCCCCGATATTTTTGGACGAGGTTTATGCAACAACGAACAACTTAACAGGAATGCTAGTTGGGAGGTTTATAGTTGGAATCGGATTGGGTATTGGTCCTCCTGTAGCATCTCTCTATATCACAGAGGTTTC...

Protein

Download Protein FASTA

254 aa · TkA03G349020|TK1151|PROTEIN

MTGRTRPFCDFEDTTRQGEREEEKPTRRKWRPCRKLDSGGDSLSPIFLDEVYATTNNLTGMLVGRFIVGIGLGIGPPVASLYITEVSPPAVRGTCGSFIQISTCLQGRNAEAEVEFQKLLGAANVRAAMAELLKSDRGDENDNVGISELVYGRHSRGRLPIHGDASSKTWLYRDRFLLLSQRLSRIPHFSTSSFNIDLSEFGSYEISKIQSLVGSTGVSWVMGVISQLEDGHFYLEDLTAAVEVNLSNAISLIT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G349020`
TK1151 ID	TkA03G349020
OH-1004 ID	LXL04_013156
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G349020

Location Chr03:85891350-85892724 (+)

Description Similar to DPB2: DNA polymerase epsilon subunit B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22110`	As accessory component of DNA polymerase II participates in chromosomal DNA replication.	Genetic analysis of two Arabidopsis DNA polymerase epsilon subunits during early embryogenesis.2005 · DOI: 10.1111/j.1365-313x.2005.02521.x
`At1g67300`	May be involved in the efflux of glucose towards the cytosol.	No verified direct reference in this release
`At1g79820`	May be involved in the efflux of glucose towards the cytosol.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013156 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0015749 monosaccharide transmembrane transport Biological Process

GO:0042276 error-prone translesion synthesis Biological Process

GO:0051781 positive regulation of cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G67300

ath:AT1G79820

ath:AT5G22110

ddi:DDB_G0278367

mmu:18974

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.285

Rank 1 · TkA03G349020 · TK1151

Cytoplasm0.255

Rank 2 · TkA03G349020 · TK1151

Endoplasmic reticulum0.206

Rank 3 · TkA03G349020 · TK1151

Mitochondrion0.139

Rank 4 · TkA03G349020 · TK1151

Cell membrane0.133

Rank 5 · TkA03G349020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083Sugar_tr55-102 aa

PF07690MFS_156-102 aa

PF29084OB_POLE2165-249 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G349020	`PF00083`	Sugar_tr	55	102	1.8e-09	37.8
TkA03G349020	`PF07690`	MFS_1	56	102	0.0011	18.7
TkA03G349020	`PF29084`	OB_POLE2	165	249	3.2e-21	76.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q500V9`	Arabidopsis thaliana	sp\|Q500V9\|DPB2_ARATH DNA polymerase epsilon subunit B	45.200%	Swiss-Prot	Medium
`Q9FYG3`	Arabidopsis thaliana	sp\|Q9FYG3\|PLST2_ARATH Probable plastidic glucose transporter 2	43.900%	Swiss-Prot	Low
`Q2V4B9`	Arabidopsis thaliana	sp\|Q2V4B9\|PLST3_ARATH Probable plastidic glucose transporter 3	42.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card