TkA03G324380 | RubberDandelionOmics

Gene overview

TkA03G324380

Reference: TK1151 Chr: Chr03 Coordinates: 79718281-79719854 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

739 bp · TkA03G324380|TK1151|cDNA

ATGGCGCCTCCGGGATCCCGAAACCGCCGTTCGCTCCACATGCGACACCGCAAAGCTGCATTGATTGCCGTTACAGAACAGGAGTTGAACTCTCAGACCGCGGCAACTCTGTGTTTAGCATCGGTTGTTGATGGCGCACCGGATCGTGACCCCTATTATTTGAAGACCTTTGAGGCTGGAAATAATTTCAGCCATTCAGCCCTCCAGGAGAGCAGTGATACTGTGATAGATAGTATAGAAACAGCAGGTGGAAAGATTGA...

CDS

Download CDS FASTA

387 bp · TkA03G324380|TK1151|CDS

ATGGCGCCTCCGGGATCCCGAAACCGCCGTTCGCTCCACATGCGACACCGCAAAGCTGCATTGATTGCCGTTACAGAACAGGAGTTGAACTCTCAGACCGCGGCAACTCTGTGTTTAGCATCGGTTGTTGATGGCGCACCGGATCGTGACCCCTATTATTTGAAGACCTTTGAGGCTGGAAATAATTTCAGCCATTCAGCCCTCCAGGAGAGCAGTGATACTGTGATAGATAGTATAGAAACAGCAGGTGGAAAGATTGA...

Protein

Download Protein FASTA

128 aa · TkA03G324380|TK1151|PROTEIN

MAPPGSRNRRSLHMRHRKAALIAVTEQELNSQTAATLCLASVVDGAPDRDPYYLKTFEAGNNFSHSALQESSDTVIDSIETAGGKIDYVEIVEQESLEAVEEITNGGVAMCVAQLQHDLESNETTSTT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G324380`
TK1151 ID	TkA03G324380
OH-1004 ID	LXL04_008834
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G324380`
Location	Chr03:79718281-79719854 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008834` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009793 embryo development ending in seed dormancy Biological Process GO:0015940 pantothenate biosynthetic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0004592 pantoate-beta-alanine ligase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference	ath:AT5G48840 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.481

Rank 1 · TkA03G324380 · TK1151

Cytoplasm0.399

Rank 2 · TkA03G324380 · TK1151

Cell membrane0.099

Rank 3 · TkA03G324380 · TK1151

Mitochondrion0.092

Rank 4 · TkA03G324380 · TK1151

Endoplasmic reticulum0.059

Rank 5 · TkA03G324380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24714TOR1L1_N22-55 aa

PF07819PGAP122-110 aa

PF02569Pantoate_ligase64-113 aa

PF21411Rap1_C_Sp76-86 aa

PF21411Rap1_C_Sp91-115 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G324380	`PF24714`	TOR1L1_N	22	55	4.8e-05	23.5
TkA03G324380	`PF07819`	PGAP1	22	110	0.052	14.0
TkA03G324380	`PF02569`	Pantoate_ligase	64	113	0.099	12.5
TkA03G324380	`PF21411`	Rap1_C_Sp	76	86	0.22	11.8
TkA03G324380	`PF21411`	Rap1_C_Sp	91	115	0.22	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card