TkA03G320760 | RubberDandelionOmics

Gene overview

TkA03G320760

Reference: TK1151 Chr: Chr03 Coordinates: 78859054-78859455 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

402 bp · TkA03G320760|TK1151|cDNA

ATGGGCGTGAGATTTGATCCAATGTTGGTCCAGCAAGAGCACGACTCCAAACCCCAAAACCCCAAATCATCATCACTGCCAACATCCCTACGCCCAAATCGGTTCTCTCCATCCAAATCCCTTGATTTCTCCACATGGTTCTCCGAAAATCTCTACAAAATCGTCACAATTGGCCTCCTAATCTCAACAGTCGCCGCTCTCTTTTTCCTCCGTAACGTCGGGGACTCCGCTGCACTCCTCTGCTTCCAATCGCAAACCCA...

CDS

Download CDS FASTA

402 bp · TkA03G320760|TK1151|CDS

ATGGGCGTGAGATTTGATCCAATGTTGGTCCAGCAAGAGCACGACTCCAAACCCCAAAACCCCAAATCATCATCACTGCCAACATCCCTACGCCCAAATCGGTTCTCTCCATCCAAATCCCTTGATTTCTCCACATGGTTCTCCGAAAATCTCTACAAAATCGTCACAATTGGCCTCCTAATCTCAACAGTCGCCGCTCTCTTTTTCCTCCGTAACGTCGGGGACTCCGCTGCACTCCTCTGCTTCCAATCGCAAACCCA...

Protein

Download Protein FASTA

133 aa · TkA03G320760|TK1151|PROTEIN

MGVRFDPMLVQQEHDSKPQNPKSSSLPTSLRPNRFSPSKSLDFSTWFSENLYKIVTIGLLISTVAALFFLRNVGDSAALLCFQSQTQHLTLHQLVALYPSTFSLTLRFISSTQFLSIIFFLLLQIQEKFLFVL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G320760`
TK1151 ID	TkA03G320760
OH-1004 ID	LXL04_036256
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	96.800
Protein coverage (%)	TK1151 69.173 / OH-1004 12.047 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G320760

Location Chr03:78859054-78859455 (+)

Description Similar to STL1: Probable glycosyltransferase STELLO1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g57420`	Probable glycosyltransferase regulating the assembly and trafficking of cellulose synthase complexes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036256 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008104 intracellular protein localization Biological Process

GO:0052324 plant-type cell wall cellulose biosynthetic process Biological Process

GO:2001009 regulation of plant-type cell wall cellulose biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016757 glycosyltransferase activity Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT2G41770

ath:AT3G57420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.342

Rank 1 · TkA03G320760 · TK1151

Endoplasmic reticulum0.284

Rank 2 · TkA03G320760 · TK1151

Cytoplasm0.201

Rank 3 · TkA03G320760 · TK1151

Mitochondrion0.120

Rank 4 · TkA03G320760 · TK1151

Cell membrane0.088

Rank 5 · TkA03G320760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCN0`	Arabidopsis thaliana	sp\|Q9SCN0\|STL2_ARATH Probable glycosyltransferase STELLO2	51.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card