TkA03G314800 | RubberDandelionOmics

Gene overview

TkA03G314800

Reference: TK1151 Chr: Chr03 Coordinates: 77329973-77334192 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3358 bp · TkA03G314800|TK1151|cDNA

ATGAAATAAATAAATTTTAATTATTAAACTAAAACACCTTCAATTATATTACATAATTTATTTTATCCCGTGTAGTACACGGGGTAATAACCTAGTTTTTTATTATATAGCCAGCTCTTGTACAGATATGACTTGATTAATTTCACCCCACAAGTCTGTGTTCAACTGTTCACCGCTATAAAGTGGAGGTATTTAAGGTTATAAAGCATGGGACAAGAACCATGAGGAAATGCAGTAGAAAAGCTTGGACTTCATGGATG...

CDS

Download CDS FASTA

582 bp · TkA03G314800|TK1151|CDS

ATGCAAGTAATTGTAAGAGCAATAAAAGCTTGCCAAGAAAGGTTTCGTATACCAGTTGTGCATCAATTACACAAGTATACCGACAATGCATCCATTATAGATTCTCAAAAGGGTATGGAAAATACTACGGTGGCTGAAGTTTTAATGACAAAAGAAGATGGAAAAGTTGGGTCTTGGCTTTGGTGCAAGACCGATGACACTGTCTATGATGCTGTGAAACAAATGGCTCGAAACAATATTGGATCCTTAGTAGTCTTAAA...

Protein

Download Protein FASTA

193 aa · TkA03G314800|TK1151|PROTEIN

MQVIVRAIKACQERFRIPVVHQLHKYTDNASIIDSQKGMENTTVAEVLMTKEDGKVGSWLWCKTDDTVYDAVKQMARNNIGSLVVLKPGDDQMIAGIVTERDYLQKVIVKDRSSKYMRVSEIMTEQNKLVTVTSDTNIYQAMRLMSENQIRHVPVIDGRIVGMISIVDVVRAVVDQQGKEVNKLNEFIKGDYY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G314800`
TK1151 ID	TkA03G314800
OH-1004 ID	LXL04_031948
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	30.100
Protein coverage (%)	TK1151 62.694 / OH-1004 21.612 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G314800

Location Chr03:77329973-77334192 (-)

Description Similar to CBSCBSPB5: CBS domain-containing protein CBSCBSPB5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g10860`	CBS domain-containing protein CBSX3, mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031948 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009536 plastid Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT2G36500

ath:AT3G52950

ath:AT5G50530

ath:AT5G50640

ath:AT5G63490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.455

Rank 1 · TkA03G314800 · TK1151

Nucleus0.258

Rank 2 · TkA03G314800 · TK1151

Mitochondrion0.153

Rank 3 · TkA03G314800 · TK1151

Cell membrane0.117

Rank 4 · TkA03G314800 · TK1151

Extracellular0.087

Rank 5 · TkA03G314800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00571CBS13-20 aa

PF07299EF-G-binding_N22-49 aa

PF28390DUF838931-61 aa

PF18298NusG_add38-56 aa

PF00571CBS60-106 aa

PF07299EF-G-binding_N64-102 aa

PF18298NusG_add95-177 aa

PF05290Baculo_IE-1109-141 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G314800	`PF00571`	CBS	13	20	5.6e-24	84.9
TkA03G314800	`PF07299`	EF-G-binding_N	22	49	0.12	13.6
TkA03G314800	`PF28390`	DUF8389	31	61	0.086	13.5
TkA03G314800	`PF18298`	NusG_add	38	56	0.034	15.2
TkA03G314800	`PF00571`	CBS	60	106	5.6e-24	84.9
TkA03G314800	`PF07299`	EF-G-binding_N	64	102	0.12	13.6
TkA03G314800	`PF18298`	NusG_add	95	177	0.034	15.2
TkA03G314800	`PF05290`	Baculo_IE-1	109	141	0.21	12.3
TkA03G314800	`PF07299`	EF-G-binding_N	116	153	0.12	13.6
TkA03G314800	`PF00571`	CBS	119	174	5.6e-24	84.9
TkA03G314800	`PF28390`	DUF8389	147	182	0.086	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LEV3`	Arabidopsis thaliana	sp\|Q9LEV3\|CBSX3_ARATH CBS domain-containing protein CBSX3, mitochondrial	56.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card