TkA03G310270 | RubberDandelionOmics

Gene overview

TkA03G310270

Reference: TK1151 Chr: Chr03 Coordinates: 76259038-76262345 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2335 bp · TkA03G310270|TK1151|cDNA

TTCAAAGTCATCAACGGTAGCATTTTCTTTTCAAAATACACAAACTCTTTGAGTTTTGGCTTTTACACACCCTCACTCTGTGAACGCCAACCTGCAATCGACATAACTCCATCTTCTGCTCCCTCTCACGCGAACGCCATTACTTCTTCTCCATAATCGATTGCCCTCTGAATTCGCTATCTGCTTTAATCGCCATCGCCATCTACCTGCTTTAATCACCTGAACGCCATTAACTCCATCTCTATTAATCGCCCTCTGCG...

CDS

Download CDS FASTA

1704 bp · TkA03G310270|TK1151|CDS

ATGGATGAGGCCAAAGAGACTCAATTTCAGGCGAAGAAAACACCAGCCTTCACTGTACTGAAGAACGGTTCCATCCTCAAGAACATCTTTCTTCTCCCTAAATCATCTCCTTTCTCACCTGATGAAGAAGTTTTGCTTGTTGGACGACATCCAGATTGCAACATCACTTTGGAGCACCCTAGTATCAGCAGATACCATCTCCGTATCCACTTAAATCCTTCTTCCCACTTGCTCTCCATAATTGACCTATCATCTGTTCA...

Protein

Download Protein FASTA

567 aa · TkA03G310270|TK1151|PROTEIN

MDEAKETQFQAKKTPAFTVLKNGSILKNIFLLPKSSPFSPDEEVLLVGRHPDCNITLEHPSISRYHLRIHLNPSSHLLSIIDLSSVHGTWVSGKKIKPGVHVKMEEGDTVKMGGSSRVYELHWVPLSQAFDVNDPFVPSMFRKQEETQDESCSYLETHSSEEDLERSDFSFSNHETIKDDLFSVPNPLDSSIDVSIQTPPECMSETEIFDSINKPEDLSVSVFDAVKTHEEDALHQDIGTENESVYHQKIDNMGYEFEQI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G310270`
TK1151 ID	TkA03G310270
OH-1004 ID	LXL04_008927
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.900
Protein coverage (%)	TK1151 100.000 / OH-1004 90.521 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G310270

Location Chr03:76259038-76262345 (+)

Description Similar to PS1: FHA domain-containing protein PS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g34355`	Required for normal spindle orientation at male meiosis II and normal formation of tetrad of microspores.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008927 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0051295 establishment of meiotic spindle localization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0004864 protein phosphatase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT1G34355

ath:AT5G47790

cel:CELE_ZK632.2

hsa:22950

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.849

Rank 1 · TkA03G310270 · TK1151

Cytoplasm0.205

Rank 2 · TkA03G310270 · TK1151

Cell membrane0.034

Rank 3 · TkA03G310270 · TK1151

Mitochondrion0.021

Rank 4 · TkA03G310270 · TK1151

Endoplasmic reticulum0.019

Rank 5 · TkA03G310270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17112Tom65-24 aa

PF16697Yop-YscD_cpl41-113 aa

PF00498FHA46-113 aa

PF00498FHA315-324 aa

PF17146PIN_6318-339 aa

PF13638PIN_4362-373 aa

PF11848DUF3368397-495 aa

PF13638PIN_4398-518 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G310270	`PF17112`	Tom6	5	24	0.21	11.8
TkA03G310270	`PF16697`	Yop-YscD_cpl	41	113	2.3e-07	31.8
TkA03G310270	`PF00498`	FHA	46	113	2.5e-16	60.5
TkA03G310270	`PF00498`	FHA	315	324	2.5e-16	60.5
TkA03G310270	`PF17146`	PIN_6	318	339	0.22	12.7
TkA03G310270	`PF13638`	PIN_4	362	373	4e-14	53.8
TkA03G310270	`PF11848`	DUF3368	397	495	0.0028	18.5
TkA03G310270	`PF13638`	PIN_4	398	518	4e-14	53.8
TkA03G310270	`PF17146`	PIN_6	398	447	0.22	12.7
TkA03G310270	`PF18477`	PIN_9	399	468	0.049	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B7SY83`	Arabidopsis thaliana	sp\|B7SY83\|PS1_ARATH FHA domain-containing protein PS1	53.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card