TkA03G309480 | RubberDandelionOmics

Gene overview

TkA03G309480

Reference: TK1151 Chr: Chr03 Coordinates: 76084001-76085395 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

549 bp · TkA03G309480|TK1151|cDNA

CCGATTTCTAATTCACCCGCCTCCATACTCCCTCTTGGCCGCGACTCGCCTCCTGCTTCCGATTCAACTTCGTTGCTCCAGTTCTTCTCCGGTGACTTCACCTCGGTTCTCCTTCTTCTCCCGGCGACTACACCTTGGTTCTGCCATTCTCCTTCTGCCGTGACTCGCCTCCTGCTTCCGATTCCATTGAGTAGCGCCGGCAACTTCGACTGAATTCCAGGGAGAGCCATGAATGCCCCAGATCGTTATGAGCGCTTTGT...

CDS

Download CDS FASTA

321 bp · TkA03G309480|TK1151|CDS

ATGAATGCCCCAGATCGTTATGAGCGCTTTGTGGTTCCTGAGGGCACAAAGAAGGTTTCCTATGAAAGGGACACAAAGATCATAAATGCTGCCTCCTTCACTATTGAGAGAGAAGATCACACTATTGGAAACATCGTTCGCATGCAGTTGCATAGGGATGGGAATGTTCTGTTTGCTGGTTACAAGCTTCCTCACCCTCTTCAGTACAAAATTATCATTCGGGTGCATACAAGTAGCCAGTCTTCACCAATGCAGGCCTA...

Protein

Download Protein FASTA

107 aa · TkA03G309480|TK1151|PROTEIN

MNAPDRYERFVVPEGTKKVSYERDTKIINAASFTIEREDHTIGNIVRMQLHRDGNVLFAGYKLPHPLQYKIIIRVHTSSQSSPMQAYNLAINDLDKELDHLKAAFEV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G309480`
TK1151 ID	TkA03G309480
OH-1004 ID	LXL04_034040
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.065 / OH-1004 91.379 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G309480

Location Chr03:76084001-76085395 (+)

Description Similar to NRPB11: DNA-directed RNA polymerases II, IV and V subunit 11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52090`	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034040 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006367 transcription initiation at RNA polymerase II promoter Biological Process

GO:0006368 transcription elongation by RNA polymerase II Biological Process

GO:0000418 RNA polymerase IV complex Cellular Component

GO:0000419 RNA polymerase V complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005665 RNA polymerase II, core complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003899 DNA-directed RNA polymerase activity Molecular Function

GO:0030275 LRR domain binding Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT3G52090

bta:540428

ddi:DDB_G0277677

hsa:5439

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.749

Rank 1 · TkA03G309480 · TK1151

Cytoplasm0.423

Rank 2 · TkA03G309480 · TK1151

Endoplasmic reticulum0.037

Rank 3 · TkA03G309480 · TK1151

Cell membrane0.032

Rank 4 · TkA03G309480 · TK1151

Mitochondrion0.028

Rank 5 · TkA03G309480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13656RNA_pol_L_231-102 aa

PF01193RNA_pol_L33-97 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G309480	`PF13656`	RNA_pol_L_2	31	102	3.3e-26	91.5
TkA03G309480	`PF01193`	RNA_pol_L	33	97	4.3e-05	23.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38859`	Arabidopsis thaliana	sp\|Q38859\|NRPBB_ARATH DNA-directed RNA polymerases II, IV and V subunit 11	87.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card