Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3049 bp · TkA03G300580|TK1151|cDNA
AAAACTTAAATCGAAACCATCAAAGGATACGTGCATGGAGTGACAAACTGTTGATGAGGGACAACTTTTATCCGTACATCTGTCTTATGATTCTTCCGATATGATTTCTGAAGAAGACGCTTCCGAACGGATCTCCATCTCTCCGATGGATATTTCTCACGAATTCGATTTTTAGAGAAGGGTCGAAAGATTTGAACAAAATTTATGGTTGACATCGAGGAAGGACAGAGAGCTAGGAAGAAATGGCGAAATCGAGCGCC...
2586 bp · TkA03G300580|TK1151|CDS
ATGGCGAAATCGAGCGCCGATGATAAGGAGCTCCGGCGAGCCTGCGAAGATGCAATTGAAGGCACGAAACAGAGGATTATAATGTCAATTCGTGTTGCGAAAAGCAAGGGTGCATGGGGAAAAGGAAAAATCGGCAGCAAAGGTAGTCAGATGGCTAAACCTAGGGTTATTGCCGTCTCCACAAAAGATAAAGGTGAAAAATCCAAAGCTTTTCTCCGCGTCTTTAAGTATACAAGCGGGGGAGCTCTTGAGCAAGCAAA...
Protein
Download Protein FASTA861 aa · TkA03G300580|TK1151|PROTEIN
MAKSSADDKELRRACEDAIEGTKQRIIMSIRVAKSKGAWGKGKIGSKGSQMAKPRVIAVSTKDKGEKSKAFLRVFKYTSGGALEQAKIYKLKRLAKMEVITSDPTGCTFQLGFDNLRNQRVAPIQWTMRNLDDRNRLLVCILTICKDAMGHLPKVVGIDIVELALWAKEHASEVPKQHGYEGGDVGDMIAEGDSGGADNDLVSQAEEEDIEALLGTYVMGIGEAEVFSERLKRELHALEAANVHAILESQHLVDEVLEGL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G300580 |
|---|---|
| TK1151 ID | TkA03G300580 |
| OH-1004 ID | LXL04_008983 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G300580 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:73893946-73899900 (-) | |||||||||
| Description | Similar to SEC3A: Exocyst complex component SEC3A | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000281 mitotic cytokinesis Biological Process GO:0006887 exocytosis Biological Process GO:0006893 Golgi to plasma membrane transport Biological Process GO:0006904 vesicle docking involved in exocytosis Biological Process GO:0015031 protein transport Biological Process GO:0016241 regulation of macroautophagy Biological Process GO:0048868 pollen tube development Biological Process GO:0051607 defense response to virus Biological Process GO:0060321 acceptance of pollen Biological Process GO:0090148 membrane fission Biological Process GO:0090522 vesicle tethering involved in exocytosis Biological Process GO:0000145 exocyst Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G47550 ath:AT1G47560 dme:Dmel_CG3885 hsa:55763 mmu:69940 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF15277Sec3-PIP2_bind51-146 aaPF09763Sec3_CC224-353 aaPF04849HAP1_N229-317 aaPF10473CENP-F_leu_zip229-318 aaPF21037CCDC138_cc230-250 aaPF29997SPC25_N253-318 aaPF04129Vps52_CC257-392 aaPF21037CCDC138_cc283-315 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G300580 | PF15277 | Sec3-PIP2_bind | 51 | 146 | 1.7e-13 | 51.2 |
| TkA03G300580 | PF09763 | Sec3_CC | 224 | 353 | 1.3e-26 | 93.7 |
| TkA03G300580 | PF04849 | HAP1_N | 229 | 317 | 0.043 | 13.7 |
| TkA03G300580 | PF10473 | CENP-F_leu_zip | 229 | 318 | 5.2 | 7.8 |
| TkA03G300580 | PF21037 | CCDC138_cc | 230 | 250 | 0.76 | 10.6 |
| TkA03G300580 | PF29997 | SPC25_N | 253 | 318 | 1.0 | 10.4 |
| TkA03G300580 | PF04129 | Vps52_CC | 257 | 392 | 2.7e-07 | 31.2 |
| TkA03G300580 | PF21037 | CCDC138_cc | 283 | 315 | 0.76 | 10.6 |
| TkA03G300580 | PF10506 | USHBP1_PDZ-bd | 284 | 318 | 0.078 | 13.8 |
| TkA03G300580 | PF20654 | Sec3_C-term | 397 | 432 | 7.3e-24 | 85.3 |
| TkA03G300580 | PF29997 | SPC25_N | 399 | 432 | 1.0 | 10.4 |
| TkA03G300580 | PF21037 | CCDC138_cc | 556 | 571 | 0.76 | 10.6 |
| TkA03G300580 | PF20654 | Sec3_C-term | 558 | 844 | 7.3e-24 | 85.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.