TkA03G298880 | RubberDandelionOmics

Gene overview

TkA03G298880

Reference: TK1151 Chr: Chr03 Coordinates: 73527779-73529873 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1442 bp · TkA03G298880|TK1151|cDNA

TGCTTTACAGGAGATTCGTACACGAATAAATCCATTATTGGGGGTGTTACTGGAGGTGTAAGCTTACTGTTACTTACACTAGCAATTTTCTTATGGTGTCACAAAACCAAAACCACAGGTAGAGGCCAACGAGATATTTCAACCGGATCTACTGAATTACTACAAGGTCCAGTTAGATATAGCTACAATGATTTAAAATTAGCCACGGATAATTTCAGCCAAGAGAACAAACTTGGAGGAGGAGTATTTGGAGAAGTATA...

CDS

Download CDS FASTA

1155 bp · TkA03G298880|TK1151|CDS

TGCTTTACAGGAGATTCGTACACGAATAAATCCATTATTGGGGGTGTTACTGGAGGTGTAAGCTTACTGTTACTTACACTAGCAATTTTCTTATGGTGTCACAAAACCAAAACCACAGGTAGAGGCCAACGAGATATTTCAACCGGATCTACTGAATTACTACAAGGTCCAGTTAGATATAGCTACAATGATTTAAAATTAGCCACGGATAATTTCAGCCAAGAGAACAAACTTGGAGGAGGAGTATTTGGAGAAGTATA...

Protein

Download Protein FASTA

384 aa · TkA03G298880|TK1151|PROTEIN

CFTGDSYTNKSIIGGVTGGVSLLLLTLAIFLWCHKTKTTGRGQRDISTGSTELLQGPVRYSYNDLKLATDNFSQENKLGGGVFGEVYKGIVKDGGEIAIKKTFMASRRGKTDFSDQLKIISNVHHRHILRILGYCIKGTQLFLVHQFMENGSLDHFLIGEKKRTLNWKQRFEIIYGTARGLAYLHEQYHVTIIHTDIRASNILLDSEFQPKIADFGLIRLLPEDKTHLSTKGRGSLNSGYLAPEYAIHGQLSEKVDTYSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G298880`
TK1151 ID	TkA03G298880
OH-1004 ID	LXL04_008987
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 99.740 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G298880

Location Chr03:73527779-73529873 (-)

Description Similar to CRK2: Cysteine-rich receptor-like protein kinase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70520`	Cysteine-rich receptor-like protein kinase 2.	No verified direct reference in this release
`At1g56140`	Probable LRR receptor-like serine/threonine-protein kinase At1g56140.	No verified direct reference in this release
`At1g56130`	Probable LRR receptor-like serine/threonine-protein kinase At1g56130.	No verified direct reference in this release
`At4g11490`	Putative cysteine-rich receptor-like protein kinase 33.	No verified direct reference in this release
`At1g16670`	Negative regulator of freezing tolerance that phosphorylates 14-3-3 proteins (e.g. GRF6) thus triggering their translocation from the cytosol to the nucleus in response to cold stress.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008987 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009409 response to cold Biological Process

GO:0009625 response to insect Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0010193 response to ozone Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045088 regulation of innate immune response Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0050826 response to freezing Biological Process

KEGG gene cross-reference

ath:AT1G16670

ath:AT1G56130

ath:AT1G56140

ath:AT1G70520

ath:AT4G11490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.801

Rank 1 · TkA03G298880 · TK1151

Cytoplasm0.146

Rank 2 · TkA03G298880 · TK1151

Nucleus0.086

Rank 3 · TkA03G298880 · TK1151

Endoplasmic reticulum0.069

Rank 4 · TkA03G298880 · TK1151

Golgi apparatus0.031

Rank 5 · TkA03G298880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21314TM_ErbB112-33 aa

PF00069Pkinase72-303 aa

PF07714PK_Tyr_Ser-Thr74-280 aa

PF03109ABC178-100 aa

PF03109ABC1182-225 aa

PF03109ABC1261-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G298880	`PF21314`	TM_ErbB1	12	33	2.3	8.7
TkA03G298880	`PF00069`	Pkinase	72	303	6.6e-39	134.6
TkA03G298880	`PF07714`	PK_Tyr_Ser-Thr	74	280	1.8e-45	156.0
TkA03G298880	`PF03109`	ABC1	78	100	0.00024	21.1
TkA03G298880	`PF03109`	ABC1	182	225	0.00024	21.1
TkA03G298880	`PF03109`	ABC1	261	282	0.00024	21.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAL3`	Arabidopsis thaliana	sp\|Q9CAL3\|CRK2_ARATH Cysteine-rich receptor-like protein kinase 2	42.200%	Swiss-Prot	Medium
`C0LGH3`	Arabidopsis thaliana	sp\|C0LGH3\|Y5614_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g56140	43.300%	Swiss-Prot	Medium
`C0LGH2`	Arabidopsis thaliana	sp\|C0LGH2\|Y1561_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g56130	43.200%	Swiss-Prot	Medium
`Q9LDN1`	Arabidopsis thaliana	sp\|Q9LDN1\|CRK33_ARATH Putative cysteine-rich receptor-like protein kinase 33	39.300%	Swiss-Prot	Medium
`Q93YN1`	Arabidopsis thaliana	sp\|Q93YN1\|CRPK1_ARATH Cold-responsive protein kinase 1	40.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card