TkA03G287390 | RubberDandelionOmics

Gene overview

TkA03G287390

Reference: TK1151 Chr: Chr03 Coordinates: 70941197-70941733 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

537 bp · TkA03G287390|TK1151|cDNA

ATGGAAAACACATCTCTACTATCACTGCTACAACAGACCACTCGTAGCCGAAAGCCTTCCAAGACAGGAGGAGGGATCTTTCGTATGTTCAAGCTTCTTCCGATGTTGACCTCCGGTTGCAAGATGGTGACGATGTTGGGGAGGCCACGGAAGCCACTGCTAACAGATAACGCCACCACCGGAACCCTATTTGGCTACCGGAGAGGGCGAGTCAGTTTGGCCATTCAAGAGGATCCACACCGCCTCCCAGTGTTTGTCAT...

CDS

Download CDS FASTA

537 bp · TkA03G287390|TK1151|CDS

ATGGAAAACACATCTCTACTATCACTGCTACAACAGACCACTCGTAGCCGAAAGCCTTCCAAGACAGGAGGAGGGATCTTTCGTATGTTCAAGCTTCTTCCGATGTTGACCTCCGGTTGCAAGATGGTGACGATGTTGGGGAGGCCACGGAAGCCACTGCTAACAGATAACGCCACCACCGGAACCCTATTTGGCTACCGGAGAGGGCGAGTCAGTTTGGCCATTCAAGAGGATCCACACCGCCTCCCAGTGTTTGTCAT...

Protein

Download Protein FASTA

178 aa · TkA03G287390|TK1151|PROTEIN

MENTSLLSLLQQTTRSRKPSKTGGGIFRMFKLLPMLTSGCKMVTMLGRPRKPLLTDNATTGTLFGYRRGRVSLAIQEDPHRLPVFVIELPMNSIAFQKEMASDIVRLSLESETTSRKKKVLEEFVWAVYCNGRKYGYSIRRKQMTDDEIHVMQSLRGVSMGAGVLPGLSRKIMRWTES

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G287390`
TK1151 ID	TkA03G287390
OH-1004 ID	LXL04_008205
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 96.067 / OH-1004 34.756 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G287390`
Location	Chr03:70941197-70941733 (+)
Description	Similar to MIZ1: Protein MIZU-KUSSEI 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008205` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0009658 chloroplast organization Biological Process GO:0010274 hydrotropism Biological Process GO:0015074 DNA integration Biological Process GO:1901020 negative regulation of calcium ion transmembrane transporter activity Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0016020 membrane Cellular Component GO:0032541 cortical endoplasmic reticulum Cellular Component GO:0003676 nucleic acid binding Molecular Function
KEGG gene cross-reference	ath:AT2G41660 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.338

Rank 1 · TkA03G287390 · TK1151

Nucleus0.334

Rank 2 · TkA03G287390 · TK1151

Cytoplasm0.240

Rank 3 · TkA03G287390 · TK1151

Cell membrane0.071

Rank 4 · TkA03G287390 · TK1151

Plastid0.061

Rank 5 · TkA03G287390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04759DUF61760-169 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G287390	`PF04759`	DUF617	60	169	2.7e-40	138.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card