TkA03G232080 | RubberDandelionOmics

Gene overview

TkA03G232080

Reference: TK1151 Chr: Chr03 Coordinates: 57881628-57890876 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2634 bp · TkA03G232080|TK1151|cDNA

CTCACTTTAAACGGTTGAAGGTATGGTATCTACTTTGATTGTTAATAGAAAAAGAAAAATAATTAGTTAAATAAATAAAAGTAAAAAATAAATAAAAATGGGCAAAAAAGTCATTGTATGTCCACCGGGGACCAAAGACGCAACACAAATATACAACCAGGATCATATATGTTAAAAAATAAAATTAGGACCAAACACGCAAGTTACATTAAGTTTTAAGGGTTATTTACGTAAATTATTCTTAAATTTAATAAAAACAT...

CDS

Download CDS FASTA

1896 bp · TkA03G232080|TK1151|CDS

ATGACTCAAGAACATGCCAGTGATCCACCCCAAAACCAGTCGTCGTCTTCGTTTCCCATCAATCTGAAGTTCATCGACATCTGTTATAGAGTGAAGATCGAAAATAGTAGTAGTAACAGTTTGATTACGAGCTGGTTCGGTGGAACTGAAACCTGCTCTACTGCTCATTCCAGGATCCAAGAACGTACCATCTTGAATGGGATCACCGGAATGGTGCACCCTGGTGAACTCCTGGCTGTGTTGGGCCCGTCGGGAAGCGG...

Protein

Download Protein FASTA

631 aa · TkA03G232080|TK1151|PROTEIN

MTQEHASDPPQNQSSSSFPINLKFIDICYRVKIENSSSNSLITSWFGGTETCSTAHSRIQERTILNGITGMVHPGELLAVLGPSGSGKSTLLNALGGRLPVHQFTGTVLANGRKLSKTVLRRTGFVTQDDVLYPHLTVRETLVFCALLRLPKSLTRQEKTAVGDSVISELGLSKCENTIIGNTFIRGVSGGERKRVSIAHEMLVNPSLLILDEPTSGLDSTAAYMLVSTLAGLAHQKGKTVITSVHQPSSRVFQMFDTVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G232080`
TK1151 ID	TkA03G232080
OH-1004 ID	LXL04_026060
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	48.900
Protein coverage (%)	TK1151 99.842 / OH-1004 86.345 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G232080

Location Chr03:57881628-57890876 (+)

Description Similar to ABCG14: ABC transporter G family member 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71960`	High affinity abscisic acid (ABA) transporter that mediates the export of ABA, with a preference for (+)-ABA, through the plasma membrane, especially in vascular tissues (e.g. phloem companion cells), and is involved in the intercellular ABA signaling pathway.	ABC transporter AtABCG25 is involved in abscisic acid transport and responses.2010 · DOI: 10.1073/pnas.0912516107 ABA transport factors found in Arabidopsis ABC transporters.2010 · DOI: 10.4161/psb.5.9.12566 Intertissue signal transfer of abscisic acid from vascular cells to guard cells.2014 · DOI: 10.1104/pp.114.235556 Abscisic acid transporters cooperate to control seed germination.2015 · DOI: 10.1038/ncomms9113
`At1g31770`	Positive regulator of plant growth which acts as an efflux pump involved in the major root-to-shoot (acropetal) long-distance cytokinin (CK) transport via the xylem sap.	ABCG9, ABCG11 and ABCG14 ABC transporters are required for vascular development in Arabidopsis.2013 · DOI: 10.1111/tpj.12334 Arabidopsis ABCG14 protein controls the acropetal translocation of root-synthesized cytokinins.2014 · DOI: 10.1038/ncomms4274 Arabidopsis ABCG14 is essential for the root-to-shoot translocation of cytokinin.2014 · DOI: 10.1073/pnas.1321519111 Cytokinin Response Factor 6 Represses Cytokinin-Associated Genes during Oxidative Stress.2016 · DOI: 10.1104/pp.16.00415 A Role of Cytokinin Transporter in Arabidopsis Immunity.2017 · DOI: 10.1094/mpmi-01-17-0011-r
`At3g25620`	ABC transporter G family member 21.	No verified direct reference in this release
`At4g27420`	Together with ABCG31, involved in pollen coat deposition of steryl glycosides required for pollen fitness.	ABCG9, ABCG11 and ABCG14 ABC transporters are required for vascular development in Arabidopsis.2013 · DOI: 10.1111/tpj.12334 The role of Arabidopsis ABCG9 and ABCG31 ATP binding cassette transporters in pollen fitness and the deposition of steryl glycosides on the pollen coat.2014 · DOI: 10.1105/tpc.113.118935
`At5g06530`	ABC transporter G family member 22.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026060 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0010115 regulation of abscisic acid biosynthetic process Biological Process

GO:0010148 transpiration Biological Process

GO:0010184 cytokinin transport Biological Process

GO:0010208 pollen wall assembly Biological Process

GO:0010222 stem vascular tissue pattern formation Biological Process

GO:0010588 cotyledon vascular tissue pattern formation Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0140115 export across plasma membrane Biological Process

KEGG gene cross-reference

ath:AT1G31770

ath:AT3G25620

ath:AT4G27420

ath:AT5G06530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.494

Rank 1 · TkA03G232080 · TK1151

Lysosome / Vacuole0.198

Rank 2 · TkA03G232080 · TK1151

Endoplasmic reticulum0.157

Rank 3 · TkA03G232080 · TK1151

Cytoplasm0.148

Rank 4 · TkA03G232080 · TK1151

Golgi apparatus0.104

Rank 5 · TkA03G232080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20703nSTAND162-94 aa

PF00005ABC_tran65-216 aa

PF09818ABC_ATPase67-95 aa

PF13481AAA_2568-93 aa

PF13191AAA_1670-110 aa

PF03193RsgA_GTPase71-99 aa

PF00437T2SSE71-99 aa

PF13555AAA_2972-95 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G232080	`PF20703`	nSTAND1	62	94	0.004	17.6
TkA03G232080	`PF00005`	ABC_tran	65	216	2.2e-28	100.3
TkA03G232080	`PF09818`	ABC_ATPase	67	95	0.02	14.6
TkA03G232080	`PF13481`	AAA_25	68	93	0.037	14.4
TkA03G232080	`PF13191`	AAA_16	70	110	0.0069	17.6
TkA03G232080	`PF03193`	RsgA_GTPase	71	99	0.0019	18.8
TkA03G232080	`PF00437`	T2SSE	71	99	0.19	11.0
TkA03G232080	`PF13555`	AAA_29	72	95	0.00071	20.0
TkA03G232080	`PF25199`	nSTAND_NTPase5	74	100	0.078	13.5
TkA03G232080	`PF13401`	AAA_22	76	109	0.006	17.6
TkA03G232080	`PF13604`	AAA_30	76	126	0.3	11.5
TkA03G232080	`PF02463`	SMC_N	77	95	0.018	15.2
TkA03G232080	`PF13671`	AAA_33	77	106	0.11	13.5
TkA03G232080	`PF25683`	URGCP_GTPase	77	97	0.31	10.5
TkA03G232080	`PF13304`	AAA_21	78	95	6.7e-06	27.0
TkA03G232080	`PF00350`	Dynamin_N	78	98	0.07	13.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84TH5`	Arabidopsis thaliana	sp\|Q84TH5\|AB25G_ARATH ABC transporter G family member 25	63.300%	Swiss-Prot	High
`Q9C6W5`	Arabidopsis thaliana	sp\|Q9C6W5\|AB14G_ARATH ABC transporter G family member 14	51.000%	Swiss-Prot	High
`Q7XA72`	Arabidopsis thaliana	sp\|Q7XA72\|AB21G_ARATH ABC transporter G family member 21	50.200%	Swiss-Prot	High
`Q9SZR9`	Arabidopsis thaliana	sp\|Q9SZR9\|AB9G_ARATH ABC transporter G family member 9	49.500%	Swiss-Prot	Medium
`Q93YS4`	Arabidopsis thaliana	sp\|Q93YS4\|AB22G_ARATH ABC transporter G family member 22	44.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card