Gene Card
Gene overview
cDNA / CDS / Protein Sequences
906 bp · TkA03G221790|TK1151|cDNA
ATGGTCGACCGACGTACCAAGAGATGGGGGTTAGTGCATACTCATCATTTGCAAGAATTGGAGGTGGACTTTATGAGCAACAAAAGAGGAGAGTTGACTCTTCAACAAATCTGTGGTGATTTTAATTCGGTTCCTGGAAGGGTTACAGATGTTGGCATATCACATCTGGTAAAGAACTGCAAGCATATTGTTGAGTTGAACTTAAGTGGCTGTAAGTGTCTAGAGTTGCTAGATATCACTAGGTGCATTAAGATAACAGA...
906 bp · TkA03G221790|TK1151|CDS
ATGGTCGACCGACGTACCAAGAGATGGGGGTTAGTGCATACTCATCATTTGCAAGAATTGGAGGTGGACTTTATGAGCAACAAAAGAGGAGAGTTGACTCTTCAACAAATCTGTGGTGATTTTAATTCGGTTCCTGGAAGGGTTACAGATGTTGGCATATCACATCTGGTAAAGAACTGCAAGCATATTGTTGAGTTGAACTTAAGTGGCTGTAAGTGTCTAGAGTTGCTAGATATCACTAGGTGCATTAAGATAACAGA...
Protein
Download Protein FASTA301 aa · TkA03G221790|TK1151|PROTEIN
MVDRRTKRWGLVHTHHLQELEVDFMSNKRGELTLQQICGDFNSVPGRVTDVGISHLVKNCKHIVELNLSGCKCLELLDITRCIKITDGSLQHIMTKCSGLKSLNLYALSSFTDEAYKKLSLLGNLRFLDLCGAQNLSDEGLLSIAKCKNIRTLSLTWFVRSNTRPPPPTTMERVAGGGLNSPELRLPARTYTSLYGSRENRYMVAGKRSQPRYKDFPSMQGLIQLDAKGTSAHCHHGHGGWWQWGRRKKLTEGWNRTPER...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G221790 |
|---|---|
| TK1151 ID | TkA03G221790 |
| OH-1004 ID | LXL04_000289 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 98.000 |
| Protein coverage (%) | TK1151 50.166 / OH-1004 65.368Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G221790 | ||||||
|---|---|---|---|---|---|---|---|
| Location | Chr03:55458741-55463750 (+) | ||||||
| Description | Similar to At3g58530: F-box protein At3g58530 | ||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||
| GO annotations (OH1004 source) | GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0009734 auxin-activated signaling pathway Biological Process GO:0010311 lateral root formation Biological Process GO:0016567 protein ubiquitination Biological Process GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0051781 positive regulation of cell division Biological Process GO:0071365 cellular response to auxin stimulus Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0019005 SCF ubiquitin ligase complex Cellular Component | ||||||
| KEGG gene cross-reference | ath:AT1G21410 ath:AT3G58530 bta:531211 hsa:144699 mmu:101358 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13516LRR_615-22 aaPF25372LRR_FBXL1543-70 aaPF25372LRR_FBXL1547-155 aaPF12799LRR_452-77 aaPF29594LRR_SKP253-72 aaPF29477COS111_C53-70 aaPF19729LRR_FBXL1858-108 aaPF23952LRR_EndoS59-107 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G221790 | PF13516 | LRR_6 | 15 | 22 | 0.9 | 10.5 |
| TkA03G221790 | PF25372 | LRR_FBXL15 | 43 | 70 | 4.5e-07 | 29.3 |
| TkA03G221790 | PF25372 | LRR_FBXL15 | 47 | 155 | 4.5e-07 | 29.3 |
| TkA03G221790 | PF12799 | LRR_4 | 52 | 77 | 3e-05 | 24.8 |
| TkA03G221790 | PF29594 | LRR_SKP2 | 53 | 72 | 1.4e-07 | 31.7 |
| TkA03G221790 | PF29477 | COS111_C | 53 | 70 | 1.6 | 9.1 |
| TkA03G221790 | PF19729 | LRR_FBXL18 | 58 | 108 | 0.83 | 8.7 |
| TkA03G221790 | PF23952 | LRR_EndoS | 59 | 107 | 0.78 | 10.7 |
| TkA03G221790 | PF13516 | LRR_6 | 59 | 72 | 0.9 | 10.5 |
| TkA03G221790 | PF23598 | LRR_14 | 60 | 129 | 0.36 | 10.3 |
| TkA03G221790 | PF25013 | LRR_Zer-1 | 68 | 134 | 0.019 | 15.8 |
| TkA03G221790 | PF13516 | LRR_6 | 71 | 89 | 0.9 | 10.5 |
| TkA03G221790 | PF12799 | LRR_4 | 74 | 106 | 3e-05 | 24.8 |
| TkA03G221790 | PF29594 | LRR_SKP2 | 75 | 158 | 1.4e-07 | 31.7 |
| TkA03G221790 | PF29477 | COS111_C | 88 | 113 | 1.6 | 9.1 |
| TkA03G221790 | PF23598 | LRR_14 | 90 | 157 | 0.36 | 10.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q8LB33 | Arabidopsis thaliana | sp|Q8LB33|FB330_ARATH F-box protein At3g58530 | 66.700% | Swiss-Prot | Low |