TkA03G195730 | RubberDandelionOmics

Gene overview

TkA03G195730

Reference: TK1151 Chr: Chr03 Coordinates: 49162684-49164622 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

999 bp · TkA03G195730|TK1151|cDNA

ATGGGTAAGGCAAGCAGATGGATCAAAAACTTGGTGTTAGGCAAAAAGGAGAACAAAATCGACACCACATCTCCATCATGCACCACCGCCATTATACCAGCAACACCTTCACCTTCACACAAGAGGAGATGGAGCTTTAGAAGATCAAATAACACGGAAATAGTAGTGGGTCACAAGAGTTGCCGATCATTTGACTCCATTATTACCTCTCAGTTAGTCTCACAAACCTTGTTCGACTATGCAATTCAACAACAAAACCA...

CDS

Download CDS FASTA

999 bp · TkA03G195730|TK1151|CDS

ATGGGTAAGGCAAGCAGATGGATCAAAAACTTGGTGTTAGGCAAAAAGGAGAACAAAATCGACACCACATCTCCATCATGCACCACCGCCATTATACCAGCAACACCTTCACCTTCACACAAGAGGAGATGGAGCTTTAGAAGATCAAATAACACGGAAATAGTAGTGGGTCACAAGAGTTGCCGATCATTTGACTCCATTATTACCTCTCAGTTAGTCTCACAAACCTTGTTCGACTATGCAATTCAACAACAAAACCA...

Protein

Download Protein FASTA

332 aa · TkA03G195730|TK1151|PROTEIN

MGKASRWIKNLVLGKKENKIDTTSPSCTTAIIPATPSPSHKRRWSFRRSNNTEIVVGHKSCRSFDSIITSQLVSQTLFDYAIQQQNHTTMMVVPPPKAASYRVPRVVAVAAATKIQAAFRSYLALRGLVKLQAVVRGHLVRKRTTTMVRCMKALVSIQVRARVQRIQMVEEVESQSHLRATSRTGFVIAHERRLSAPQFDHDDNSGQFENKTSGFVTYRQSSRRFSIDSSIWKHRNSVRLQNKPKTEASAVPQMGSHHNE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G195730`
TK1151 ID	TkA03G195730
OH-1004 ID	LXL04_018169
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	40.700
Protein coverage (%)	TK1151 48.494 / OH-1004 42.520 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G195730

Location Chr03:49162684-49164622 (-)

Description Similar to IQD31: Protein IQ-DOMAIN 31

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14750`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At4g00820`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At3g59690`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At1g01110`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At4g23060`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018169 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010091 trichome branching Biological Process

GO:0051592 response to calcium ion Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0009574 preprophase band Cellular Component

GO:0016604 nuclear body Cellular Component

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT1G72670

ath:AT3G16490

ath:AT4G14750

ath:AT5G07240

ath:AT5G62070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.404

Rank 1 · TkA03G195730 · TK1151

Nucleus0.383

Rank 2 · TkA03G195730 · TK1151

Cell membrane0.379

Rank 3 · TkA03G195730 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA03G195730 · TK1151

Plastid0.032

Rank 5 · TkA03G195730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13178DUF400539-53 aa

PF00612IQ110-124 aa

PF00612IQ129-143 aa

PF15364PAXIP1_C192-205 aa

PF13178DUF4005252-306 aa

PF15364PAXIP1_C270-311 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G195730	`PF13178`	DUF4005	39	53	6.3e-07	30.6
TkA03G195730	`PF00612`	IQ	110	124	5.6e-09	35.7
TkA03G195730	`PF00612`	IQ	129	143	5.6e-09	35.7
TkA03G195730	`PF15364`	PAXIP1_C	192	205	2.9	8.7
TkA03G195730	`PF13178`	DUF4005	252	306	6.3e-07	30.6
TkA03G195730	`PF15364`	PAXIP1_C	270	311	2.9	8.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A0A1P8B590`	Arabidopsis thaliana	sp\|A0A1P8B590\|IQD19_ARATH Protein IQ-DOMAIN 19	29.500%	Swiss-Prot	Low
`F4JHN2`	Arabidopsis thaliana	sp\|F4JHN2\|IQD17_ARATH Protein IQ-DOMAIN 17	33.600%	Swiss-Prot	Low
`Q9M199`	Arabidopsis thaliana	sp\|Q9M199\|IQD13_ARATH Protein IQ-DOMAIN 13	49.200%	Swiss-Prot	Low
`Q9MAM4`	Arabidopsis thaliana	sp\|Q9MAM4\|IQD18_ARATH Protein IQ-DOMAIN 18	55.700%	Swiss-Prot	Low
`Q2NNE0`	Arabidopsis thaliana	sp\|Q2NNE0\|IQD22_ARATH Protein IQ-DOMAIN 22	48.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card