TkA03G186180 | RubberDandelionOmics

Gene overview

TkA03G186180

Reference: TK1151 Chr: Chr03 Coordinates: 46893450-46900670 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3666 bp · TkA03G186180|TK1151|cDNA

ATGACGAGCATGCTTTGGTCGCTTGTAGAGACGTCCCGCTTGCCTTGGAAAGATGGAGGAAGGAAAGATGAAGGAGGGCTCAGAGGGCCGTGGTCGTTTGGGTATTGTATAAAAGGCCTCTCAGTCCTAACCGTTGACAAGAAATTTCAAAATGAGATCACCATTGTGTCAGAAGGTTATGGAAAAGCCTGTGTATGCGTTTATGGATACATAAGTGACACCCGTGACAGTTATGAAGCTGCTCCCATGGAAGATATAAA...

CDS

Download CDS FASTA

3666 bp · TkA03G186180|TK1151|CDS

ATGACGAGCATGCTTTGGTCGCTTGTAGAGACGTCCCGCTTGCCTTGGAAAGATGGAGGAAGGAAAGATGAAGGAGGGCTCAGAGGGCCGTGGTCGTTTGGGTATTGTATAAAAGGCCTCTCAGTCCTAACCGTTGACAAGAAATTTCAAAATGAGATCACCATTGTGTCAGAAGGTTATGGAAAAGCCTGTGTATGCGTTTATGGATACATAAGTGACACCCGTGACAGTTATGAAGCTGCTCCCATGGAAGATATAAA...

Protein

Download Protein FASTA

1221 aa · TkA03G186180|TK1151|PROTEIN

MTSMLWSLVETSRLPWKDGGRKDEGGLRGPWSFGYCIKGLSVLTVDKKFQNEITIVSEGYGKACVCVYGYISDTRDSYEAAPMEDIKLPSKEQDSDCTTATRPLRSPALRCPALLHTAGKGRIITSVHHYSLQETAKPLPFDSDLEGSDLVETGNSQTGDPLDPFDPDQVILWKQEVIWWKQATAKQETANGQWSTVHPRHLQARSATIGKERRRLKEEAESRISVKETRTSVKVKEEDGSCRRLPNKEEEKRRLVKKEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G186180`
TK1151 ID	TkA03G186180
OH-1004 ID	LXL04_029458
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	81.400
Protein coverage (%)	TK1151 77.232 / OH-1004 87.679 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G186180`
Location	Chr03:46893450-46900670 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029458` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.927

Rank 1 · TkA03G186180 · TK1151

Cytoplasm0.123

Rank 2 · TkA03G186180 · TK1151

Cell membrane0.024

Rank 3 · TkA03G186180 · TK1151

Endoplasmic reticulum0.017

Rank 4 · TkA03G186180 · TK1151

Mitochondrion0.015

Rank 5 · TkA03G186180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13963Transpos_assoc284-358 aa

PF21957Zn_ribbon_16314-339 aa

PF21957Zn_ribbon_16507-524 aa

PF02992Transposase_21577-777 aa

PF21957Zn_ribbon_16713-738 aa

PF13963Transpos_assoc880-910 aa

PF13960DUF4218895-945 aa

PF13952DUF42161099-1167 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G186180	`PF13963`	Transpos_assoc	284	358	3e-22	79.3
TkA03G186180	`PF21957`	Zn_ribbon_16	314	339	0.76	10.5
TkA03G186180	`PF21957`	Zn_ribbon_16	507	524	0.76	10.5
TkA03G186180	`PF02992`	Transposase_21	577	777	1.8e-91	305.8
TkA03G186180	`PF21957`	Zn_ribbon_16	713	738	0.76	10.5
TkA03G186180	`PF13963`	Transpos_assoc	880	910	3e-22	79.3
TkA03G186180	`PF13960`	DUF4218	895	945	2.6e-10	40.9
TkA03G186180	`PF13952`	DUF4216	1099	1167	3.5e-16	60.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card