TkA03G184060 | RubberDandelionOmics

Gene overview

TkA03G184060

Reference: TK1151 Chr: Chr03 Coordinates: 46334010-46337307 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

897 bp · TkA03G184060|TK1151|cDNA

TTAGTTTGCACATGCACCGTTTTCTCGGAACAAATCTTCTACCCCTCTTACGTCTCTGCCCCTCCTTCCCTGCCTCCCCTTGTCTACATATTTTCAACTAATATCGAATCTTCAAGTAAACCACCCATTTCTTCCTTCGATTCAATACCTAATCGTCTGCTGTCAAATCCCGTCATGGAGGAAGCTAACATTGTTGAAACTAAAGACGGATCAATTTCTGTTGCTTCAGCTTTTCCTGGCCACAAGCAAGCTGTACAGGA...

CDS

Download CDS FASTA

843 bp · TkA03G184060|TK1151|CDS

CCGTTTTCTCGGAACAAATCTTCTACCCCTCTTACGTCTCTGCCCCTCCTTCCCTGCCTCCCCTTGTCTACATATTTTCAACTAATATCGAATCTTCAAGCAACTAATATCGAATCTTCAAGTAAACCACCCATTTCTTCCTTCGATTCAATACCTAATCGTCTGCTGTCAAATCCCGTCATGGAGGAAGCTAACATTGTTGAAACTAAAGACGGATCAATTTCTGTTGCTTCAGCTTTTCCTGGCCACAAGCAAGCTGT...

Protein

Download Protein FASTA

280 aa · TkA03G184060|TK1151|PROTEIN

PFSRNKSSTPLTSLPLLPCLPLSTYFQLISNLQATNIESSSKPPISSFDSIPNRLLSNPVMEEANIVETKDGSISVASAFPGHKQAVQDRDHKFLTKAVEEAYKGVDCGDGGPFGAVVVCKDEVVVSCHNMVIKHTDPTAHAEVTAIREACKKLNQIELSECEIYASCEPCPMCFGAIHLSRIKRLVYGAKAEAAIAIGFDDFIADALRGTGVYQKANLEIKKQMEMELLLLNKYLKTPKPSSQCIDAIPYIISPLNYYT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G184060`
TK1151 ID	TkA03G184060
OH-1004 ID	LXL04_007494
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 67.857 / OH-1004 37.328 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G184060

Location Chr03:46334010-46337307 (+)

Description Similar to GSDA: Guanosine deaminase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g28050`	Catalyzes the hydrolytic deamination of guanosine, producing xanthosine and ammonia.	Plant purine nucleoside catabolism employs a guanosine deaminase required for the generation of xanthosine in Arabidopsis.2013 · DOI: 10.1105/tpc.113.117184

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007494 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002100 tRNA wobble adenosine to inosine editing Biological Process

GO:0006147 guanine catabolic process Biological Process

GO:0006152 purine nucleoside catabolic process Biological Process

GO:0030148 sphingolipid biosynthetic process Biological Process

GO:0030497 fatty acid elongation Biological Process

GO:0042761 very long-chain fatty acid biosynthetic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

aae:aq_903

ath:AT5G28050

bsu:BSU13170

dre:393441

sav:SAV0558

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.787

Rank 1 · TkA03G184060 · TK1151

Cytoplasm0.191

Rank 2 · TkA03G184060 · TK1151

Nucleus0.137

Rank 3 · TkA03G184060 · TK1151

Mitochondrion0.056

Rank 4 · TkA03G184060 · TK1151

Peroxisome0.050

Rank 5 · TkA03G184060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00383dCMP_cyt_deam_190-189 aa

PF14437MafB19-deam93-194 aa

PF13570Beta-prop_ACSF4110-129 aa

PF18782APOBEC3125-178 aa

PF15193FAM24135-178 aa

PF09930DUF2162160-182 aa

PF13570Beta-prop_ACSF4243-276 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G184060	`PF00383`	dCMP_cyt_deam_1	90	189	1.9e-26	92.6
TkA03G184060	`PF14437`	MafB19-deam	93	194	6.7e-20	72.1
TkA03G184060	`PF13570`	Beta-prop_ACSF4	110	129	0.029	14.5
TkA03G184060	`PF18782`	APOBEC3	125	178	0.086	13.7
TkA03G184060	`PF15193`	FAM24	135	178	0.45	12.1
TkA03G184060	`PF09930`	DUF2162	160	182	0.12	12.6
TkA03G184060	`PF13570`	Beta-prop_ACSF4	243	276	0.029	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BU8`	Arabidopsis thaliana	sp\|Q94BU8\|GSDA_ARATH Guanosine deaminase	87.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card