TkA03G162220 | RubberDandelionOmics

Gene overview

TkA03G162220

Reference: TK1151 Chr: Chr03 Coordinates: 41138038-41143546 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3193 bp · TkA03G162220|TK1151|cDNA

TTATAATAAATAATTTTAAAACTATTTATAAATCCAATTTAGTTTTAAATTAACATCCTTTTGGTAACCACTATCAGGTTGCCCTCTTACAAAAAACTTAGACGAAATTTGACCCCCATCACGTTGTCTTCCTTATCTTCGTGGAGGCAGAGCTAGCTAGCCGTTTCTCCTTGCTTCACTCTTTCACTACCTTTTGCAGAACCCCACCACATACATGGTCGAGGAAGTTTTGTGTGCAGGTGTTTTATTGTGGGAGGTAT...

CDS

Download CDS FASTA

2763 bp · TkA03G162220|TK1151|CDS

ATGCAATCCTTATGTGAACCCTTGTGGATGTTAAGAGGTGAAGTTTCTTTTTCGCTGCATTTAGAAAGTAGTAAAAAGAGCAGAAAGATTTTGGTGAGGAGGTCATTGACTAGATCTTGTAGCAGAAGCCCATCACAGAATCTTTTTGGGTCATGGATGGTGGAGACATGGATCCCTGGTCAACCTTTGATTTCTGCTAAAGCTAAAGATGAAGCAAAACATTTGGAAAATACCGGAAGCGACTTTGTGGTCTCAAAACA...

Protein

Download Protein FASTA

920 aa · TkA03G162220|TK1151|PROTEIN

MQSLCEPLWMLRGEVSFSLHLESSKKSRKILVRRSLTRSCSRSPSQNLFGSWMVETWIPGQPLISAKAKDEAKHLENTGSDFVVSKQLLGDLDFEDDFTSELYEPFSTCYQPVEEPWLLEPSILSEYDLQLDSPNGSTSENSENETEFYPVEEPWLSIKVPTIDVSLQNQVEIDKNLKGLPNDQNQSPRVEKIFDKLTRVSVGNEKEIEKIEEIPKRLFSDDEGRVVMQEVSVDTVILINSSLCTMQRVAVMEDEKLVEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G162220`
TK1151 ID	TkA03G162220
OH-1004 ID	LXL04_007357
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.600
Protein coverage (%)	TK1151 100.000 / OH-1004 97.146 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G162220

Location Chr03:41138038-41143546 (-)

Description Similar to RNE: Ribonuclease E/G-like protein, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g04270`	Involved in intercistronic processing of primary transcripts from chloroplast operons.	A 125 kDa RNase E/G-like protein is present in plastids and is essential for chloroplast development and autotrophic growth in Arabidopsis.2008 · DOI: 10.1093/jxb/ern126

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007357 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000967 rRNA 5'-end processing Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006396 RNA processing Biological Process

GO:0006401 RNA catabolic process Biological Process

GO:0006402 mRNA catabolic process Biological Process

GO:0008033 tRNA processing Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010239 chloroplast mRNA processing Biological Process

GO:0032781 positive regulation of ATP-dependent activity Biological Process

GO:0051259 protein complex oligomerization Biological Process

GO:0051289 protein homotetramerization Biological Process

GO:0051301 cell division Biological Process

KEGG gene cross-reference

ath:AT2G04270

bab:bbp_317

ecj:JW1071

eco:b1084

ecoc:C3026_06565

hin:HI_0413

hin:HI_1353

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.940

Rank 1 · TkA03G162220 · TK1151

Mitochondrion0.054

Rank 2 · TkA03G162220 · TK1151

Nucleus0.052

Rank 3 · TkA03G162220 · TK1151

Cytoplasm0.042

Rank 4 · TkA03G162220 · TK1151

Peroxisome0.023

Rank 5 · TkA03G162220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10150RNase_E_G195-228 aa

PF10150RNase_E_G499-775 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G162220	`PF10150`	RNase_E_G	195	228	4.4e-86	289.3
TkA03G162220	`PF10150`	RNase_E_G	499	775	4.4e-86	289.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IV66`	Arabidopsis thaliana	sp\|F4IV66\|RNE_ARATH Ribonuclease E/G-like protein, chloroplastic	54.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card