TkA03G156020 | RubberDandelionOmics

Gene overview

TkA03G156020

Reference: TK1151 Chr: Chr03 Coordinates: 39570163-39572128 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1579 bp · TkA03G156020|TK1151|cDNA

TTTCTATAGCTTAAATTTCCACATCCAGACCAAAAGAATGCACAACTTAATTTGCCTGCAAAGCTATCATCATTCAAGTACCAAGTGGATGATCCAAATTCAGATCTGGTTGTCTTCCCTATTTTTTTCGTGTAAAAAAATTCATGCATTATTATTTTGTAAATTATATATAAGAAAAAGCTTCAAATTTAGATTTTGGGTTTTGTTAAAGTTAGAATACTTAATACATATTTTGATCTACAAATAGCCCATTAATTATG...

CDS

Download CDS FASTA

744 bp · TkA03G156020|TK1151|CDS

ATGGCTCCATACTTTTGCATTCGAAGGGTAAGAACACTGCGGAAAAAAGACGGACTCCCAAATGTTTCTCTTCACGCGTTTTATGTGATTGATGAAGCCAAGAAAGCGGTTGAGTCTGTGTGTCCTGGAGTCGTCTCATGTGCTGATATTTTAGCATTAGCCGCAAGAGATGCAATTGTTCTTGCTGGAGGACCATCTTGGGATGTACCTAAAGGAAGAAAAGATGGAAGAATATCAAGAGCTAGTGATACTACAAAACT...

Protein

Download Protein FASTA

247 aa · TkA03G156020|TK1151|PROTEIN

MAPYFCIRRVRTLRKKDGLPNVSLHAFYVIDEAKKAVESVCPGVVSCADILALAARDAIVLAGGPSWDVPKGRKDGRISRASDTTKLPSPTFNIAQLQQSFSLRGLSLEDVAALLGAHTLGFSHCSSFNNRIYNFNSTFDIDPSLRRSFASSLRRVCPIKNNAKNAGVTMDPYSSTTFDNTYYQLILQHKALFSTDNALLSSPMTKSLVYKFARSKDAFFKAFVKSLIKLSSINGGQEIRKDCRVVN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G156020`
TK1151 ID	TkA03G156020
OH-1004 ID	LXL04_007319
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 94.332 / OH-1004 71.037 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G156020

Location Chr03:39570163-39572128 (-)

Description Similar to PER64: Peroxidase 64

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42180`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At5g51890`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At1g05260`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007319 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009269 response to desiccation Biological Process

GO:0009409 response to cold Biological Process

GO:0042538 hyperosmotic salinity response Biological Process

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT1G05260

ath:AT3G21770

ath:AT5G42180

ath:AT5G51890

dosa:Os05g0499300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.484

Rank 1 · TkA03G156020 · TK1151

Lysosome / Vacuole0.198

Rank 2 · TkA03G156020 · TK1151

Cytoplasm0.147

Rank 3 · TkA03G156020 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA03G156020 · TK1151

Cell membrane0.052

Rank 5 · TkA03G156020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00141peroxidase15-214 aa

PF23789Pre_tape_measure96-119 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G156020	`PF00141`	peroxidase	15	214	7.3e-64	216.5
TkA03G156020	`PF23789`	Pre_tape_measure	96	119	0.033	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q43872`	Arabidopsis thaliana	sp\|Q43872\|PER64_ARATH Peroxidase 64	61.400%	Swiss-Prot	High
`Q9LT91`	Arabidopsis thaliana	sp\|Q9LT91\|PER66_ARATH Peroxidase 66	50.800%	Swiss-Prot	High
`O23044`	Arabidopsis thaliana	sp\|O23044\|PER3_ARATH Peroxidase 3	46.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card