TkA03G153680 | RubberDandelionOmics

Gene overview

TkA03G153680

Reference: TK1151 Chr: Chr03 Coordinates: 38997079-38999119 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1749 bp · TkA03G153680|TK1151|cDNA

ATGCACTTGAAACTAGGCGAAATCTGTTTTTTTATTAAAAATGACAAATGTAGGTTACGAGCAATCTGTAAAGGGGTAGTAGGAAAAAATAAAAGCAGCAATAAAGGCAAAGGAAAGGACAAATGTGTACAGGAAAAAGATTCCTCTTGTCCTTGGGTCATTCAAGCTTCAAGATCAACCACCGAAGATAATTGGTATGTGAAAACATACGTGCAGCAACATACGTGTCTGAACACAAGGAAGATTAGATCTGCAACAGC...

CDS

Download CDS FASTA

1749 bp · TkA03G153680|TK1151|CDS

ATGCACTTGAAACTAGGCGAAATCTGTTTTTTTATTAAAAATGACAAATGTAGGTTACGAGCAATCTGTAAAGGGGTAGTAGGAAAAAATAAAAGCAGCAATAAAGGCAAAGGAAAGGACAAATGTGTACAGGAAAAAGATTCCTCTTGTCCTTGGGTCATTCAAGCTTCAAGATCAACCACCGAAGATAATTGGTATGTGAAAACATACGTGCAGCAACATACGTGTCTGAACACAAGGAAGATTAGATCTGCAACAGC...

Protein

Download Protein FASTA

582 aa · TkA03G153680|TK1151|PROTEIN

MHLKLGEICFFIKNDKCRLRAICKGVVGKNKSSNKGKGKDKCVQEKDSSCPWVIQASRSTTEDNWYVKTYVQQHTCLNTRKIRSATATFLSKQIMDQVETNLTVPVKSLQSQLQKKYHVGFSIHKIFRAKSEARKHVVGDYTKQYDVLRDYILELQSTNPDTTVKLKKGFRAGMRDFLGLDGAFMKGPFPGQILTAVGVDSNNGIYPLAYAIVESENMQSWKWFLDCLGDDLDLYANSNFTFISDRQKGLIPALAQMFPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G153680`
TK1151 ID	TkA03G153680
OH-1004 ID	LXL04_018769
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	88.100
Protein coverage (%)	TK1151 95.017 / OH-1004 53.425 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G153680`
Location	Chr03:38997079-38999119 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018769` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006355 regulation of DNA-templated transcription Biological Process GO:0005634 nucleus Cellular Component GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	ath:AT1G52520 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.944

Rank 1 · TkA03G153680 · TK1151

Cytoplasm0.091

Rank 2 · TkA03G153680 · TK1151

Cell membrane0.026

Rank 3 · TkA03G153680 · TK1151

Endoplasmic reticulum0.020

Rank 4 · TkA03G153680 · TK1151

Mitochondrion0.014

Rank 5 · TkA03G153680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08731AFT14-75 aa

PF11254DUF305342-99 aa

PF11254DUF3053131-153 aa

PF10551MULE178-273 aa

PF00872Transposase_mut193-284 aa

PF04434SWIM427-456 aa

PF15288zf-CCHC_6536-550 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G153680	`PF08731`	AFT	14	75	0.026	15.6
TkA03G153680	`PF11254`	DUF3053	42	99	0.38	11.0
TkA03G153680	`PF11254`	DUF3053	131	153	0.38	11.0
TkA03G153680	`PF10551`	MULE	178	273	1.3e-19	71.1
TkA03G153680	`PF00872`	Transposase_mut	193	284	8.4e-06	25.6
TkA03G153680	`PF04434`	SWIM	427	456	6.7e-11	42.2
TkA03G153680	`PF15288`	zf-CCHC_6	536	550	1.1	9.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card