TkA03G145460 | RubberDandelionOmics

Gene overview

TkA03G145460

Reference: TK1151 Chr: Chr03 Coordinates: 37079698-37083421 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2372 bp · TkA03G145460|TK1151|cDNA

AGATTTTCGTGTAAAAGCTGTTGGATCAATTGTTAGAATACGAATATCGGGTAGTGATCAGAAGCATGATATGTACAGACTTGTCCAAGTTGTACAAGTAAGGCGGAAGCACCGTATAAGATTGGTGATAAATCTGTAGATATTATGCTTGAAGTTTTTAAATTTAGACAAGAAGAGACTGTATCAATTAATACTATTTCAAATCAAGATCTTTCGGAGGATGAATGTAGACGTTTACGACAGAGTGTAAGATGTGGGCT...

CDS

Download CDS FASTA

1044 bp · TkA03G145460|TK1151|CDS

ATGAGGATTTGGATGAAAAAAGAAGACGAATCTATACTCTTGAACGACGTTGTAAAGTCGGAATCCCCCATTCCGGTGGAGAAGTCCGGAACCGGAATCGAACGTCTCACGGTTCGGATATCGAATCCAAAGTCAACCGAGTCAACGGAAAACAACCATGTTTCTTCGGTTTTCGATGCTTCAGATGTGGAATTACCGAGTCCGACTCCGAAGATGAGAACCGAAGACGAAAAGGTGTCCGGAATTGGAATCGCGATTAA...

Protein

Download Protein FASTA

347 aa · TkA03G145460|TK1151|PROTEIN

MRIWMKKEDESILLNDVVKSESPIPVEKSGTGIERLTVRISNPKSTESTENNHVSSVFDASDVELPSPTPKMRTEDEKVSGIGIAINVGQDGRNRNLNGGKVEEWSGYSPTSGDHGGLPPVQGVCETIEFSTLAEESVSDLLAEVDAMESQNGFPSPTSTRNNFGDDLFNGYFEEFSPTPKTGPDIHFPFHSTTTTTTTTAAATTATTEQITSKNTIDVNNSTKIEANEIQRPSPSPPPPPPPPPVLQPPPLPSPPPPQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G145460`
TK1151 ID	TkA03G145460
OH-1004 ID	LXL04_007241
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.400
Protein coverage (%)	TK1151 100.000 / OH-1004 31.665 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G145460

Location Chr03:37079698-37083421 (-)

Description Similar to At3g51120: Zinc finger CCCH domain-containing protein 44

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51120`	Zinc finger CCCH domain-containing protein 44.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007241 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016593 Cdc73/Paf1 complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0042393 histone binding Molecular Function

GO:1990269 RNA polymerase II C-terminal domain phosphoserine binding Molecular Function

KEGG gene cross-reference

ath:AT2G16485

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.849

Rank 1 · TkA03G145460 · TK1151

Cytoplasm0.200

Rank 2 · TkA03G145460 · TK1151

Cell membrane0.061

Rank 3 · TkA03G145460 · TK1151

Endoplasmic reticulum0.050

Rank 4 · TkA03G145460 · TK1151

Plastid0.018

Rank 5 · TkA03G145460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16131Torus323-346 aa

PF00642zf-CCCH324-347 aa

PF18044zf-CCCH_4326-347 aa

PF18345zf_CCCH_4328-344 aa

PF14608zf-CCCH_2328-347 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G145460	`PF16131`	Torus	323	346	0.0089	17.3
TkA03G145460	`PF00642`	zf-CCCH	324	347	0.0034	18.0
TkA03G145460	`PF18044`	zf-CCCH_4	326	347	0.26	11.8
TkA03G145460	`PF18345`	zf_CCCH_4	328	344	0.0023	18.7
TkA03G145460	`PF14608`	zf-CCCH_2	328	347	0.0042	18.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SD34`	Arabidopsis thaliana	sp\|Q9SD34\|C3H44_ARATH Zinc finger CCCH domain-containing protein 44	28.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card