TkA03G141410 | RubberDandelionOmics

Gene overview

TkA03G141410

Reference: TK1151 Chr: Chr03 Coordinates: 36163249-36167916 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

771 bp · TkA03G141410|TK1151|cDNA

ATGTGTGCGGATTTTCTCACGTCGATAACGGACACGCAGCAACTAATAACGCACGAATATTGCCTCCAGATCTTGAGAGCAGATCATGAGTGGGGTAGTTTCTTTCGTGAGGTTTTAGCTGGTGAGAAGCATAGGCTATCACATTACCCCGTTGCATCGACACAGCACCAAGATCCTGAAGAGATACATCACAGTGAACTACAAATTTTTCAACCCCATCTGGCGGTTGACAATGAAATTCTTGGGAGATATTTCAATAA...

CDS

Download CDS FASTA

771 bp · TkA03G141410|TK1151|CDS

ATGTGTGCGGATTTTCTCACGTCGATAACGGACACGCAGCAACTAATAACGCACGAATATTGCCTCCAGATCTTGAGAGCAGATCATGAGTGGGGTAGTTTCTTTCGTGAGGTTTTAGCTGGTGAGAAGCATAGGCTATCACATTACCCCGTTGCATCGACACAGCACCAAGATCCTGAAGAGATACATCACAGTGAACTACAAATTTTTCAACCCCATCTGGCGGTTGACAATGAAATTCTTGGGAGATATTTCAATAA...

Protein

Download Protein FASTA

256 aa · TkA03G141410|TK1151|PROTEIN

MCADFLTSITDTQQLITHEYCLQILRADHEWGSFFREVLAGEKHRLSHYPVASTQHQDPEEIHHSELQIFQPHLAVDNEILGRYFNNCTYYKPSDHGQLRDGETQTRASHRISHDPKDYLALGVSNCGVFTSVEQHPSLRNWKNDAHMAIRDCYRAVEINPNSFRALLCMAEALSQESTIGCGKEQERKLGAFGLWENIDHLLEMCTAKLSPAAAPTLTNKLAVQKGINATTLSAYKTLAEELTKCSQLPRFTIRK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G141410`
TK1151 ID	TkA03G141410
OH-1004 ID	LXL04_010611
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	81.000
Protein coverage (%)	TK1151 24.609 / OH-1004 7.111 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G141410

Location Chr03:36163249-36167916 (+)

Description Similar to Probable cytochrome c biosynthesis protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g10940`	May function as a substrate adapter for CUL4-DDB1 E3 ubiquitin-protein ligase complex (Probable).	ASG2 is a farnesylated DWD protein that acts as ABA negative regulator in Arabidopsis.2016 · DOI: 10.1111/pce.12605 Remarkable Evolutionary Conservation of Antiobesity ADIPOSE/WDTC1 Homologs in Animals and Plants.2017 · DOI: 10.1534/genetics.116.198382

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010611 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0017004 cytochrome complex assembly Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0015232 heme transmembrane transporter activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0020037 heme binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.399

Rank 1 · TkA03G141410 · TK1151

Cytoplasm0.396

Rank 2 · TkA03G141410 · TK1151

Mitochondrion0.183

Rank 3 · TkA03G141410 · TK1151

Cell membrane0.078

Rank 4 · TkA03G141410 · TK1151

Endoplasmic reticulum0.054

Rank 5 · TkA03G141410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13431TPR_17112-122 aa

PF00515TPR_1148-162 aa

PF13431TPR_17155-176 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G141410	`PF13431`	TPR_17	112	122	0.011	16.7
TkA03G141410	`PF00515`	TPR_1	148	162	0.14	12.7
TkA03G141410	`PF13431`	TPR_17	155	176	0.011	16.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BQ3`	Arabidopsis thaliana	sp\|Q94BQ3\|ASG2_ARATH Protein ALTERED SEED GERMINATION 2	59.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card