TkA03G137590 | RubberDandelionOmics

Gene overview

TkA03G137590

Reference: TK1151 Chr: Chr03 Coordinates: 35250827-35253169 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1041 bp · TkA03G137590|TK1151|cDNA

TTTTGTAATAGTAAAGGGACTAAAGTTGAAACTTAAGCCAAAGTATAATTTGGGGGAACGACCAATTTTCATTCACGAGTTTGAACTTTGAAAGACATTCGATTTTCGACCAGAATTCGGCCACAGGAGTTCTCTCACCAAATCTGAGATCCGTGGTTCTCTACAAATAGAAGAGAAGTAATCAGCGTCTACAGACATGGATCCCGATTCAGTTAAATCAACTCTTCAAACTTTAGCATTTGGAAATGTATTGGCTGCAG...

CDS

Download CDS FASTA

687 bp · TkA03G137590|TK1151|CDS

ATGGATCCCGATTCAGTTAAATCAACTCTTCAAACTTTAGCATTTGGAAATGTATTGGCTGCAGCTGCTCGTGATTATAAGAAGGAAGTGACAGCTAATGAAAAAGCACAAGCATCATCATCTGTTAATGAAGAGTTTGATCTAGATGAGTTGATGGATGATCCTGAGCTGGAAAAGCTACATGCTGATAGGATTGCAGCTCTTAAGAGAGAAGCTGAAAAAAGACAATCATTAACGAAAAAAGGGCATGGAGAATATAG...

Protein

Download Protein FASTA

228 aa · TkA03G137590|TK1151|PROTEIN

MDPDSVKSTLQTLAFGNVLAAAARDYKKEVTANEKAQASSSVNEEFDLDELMDDPELEKLHADRIAALKREAEKRQSLTKKGHGEYREITEGDFLGEVTSSEKVICHFYHREFYRCKIMDKHLKTLATSHLDAKFVKLDAENAPFFVTKLGIKTLPCVILFRKGIAGDRLVGFQDLGGKDDFSTRKLEVLLIKKGIIEETKKDEDEAEYDESRRRTVRYSAINDSDSE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G137590`
TK1151 ID	TkA03G137590
OH-1004 ID	LXL04_001544
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	40.800
Protein coverage (%)	TK1151 68.421 / OH-1004 74.641 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G137590

Location Chr03:35250827-35253169 (+)

Description Similar to At2g18990: Thioredoxin domain-containing protein 9 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66410`	Tubulin-binding protein involved in microtubule formation.	Phosducin-Like Protein 3 is required for microtubule-dependent steps of cell division but not for meristem growth in Arabidopsis.2008 · DOI: 10.1105/tpc.107.057737
`At3g50960`	Tubulin-binding protein involved in microtubule formation.	Phosducin-Like Protein 3 is required for microtubule-dependent steps of cell division but not for meristem growth in Arabidopsis.2008 · DOI: 10.1105/tpc.107.057737
`At2g18990`	Thioredoxin domain-containing protein 9 homolog.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001544 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005813 centrosome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0030496 midbody Cellular Component

GO:0045296 cadherin binding Molecular Function

KEGG gene cross-reference

ath:AT2G18990

bta:539143

hsa:10190

mmu:98258

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.577

Rank 1 · TkA03G137590 · TK1151

Nucleus0.533

Rank 2 · TkA03G137590 · TK1151

Endoplasmic reticulum0.046

Rank 3 · TkA03G137590 · TK1151

Cell membrane0.041

Rank 4 · TkA03G137590 · TK1151

Mitochondrion0.039

Rank 5 · TkA03G137590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF31212AvrRxo1-ORF216-53 aa

PF15944DUF475218-54 aa

PF11240DUF304218-30 aa

PF00085Thioredoxin88-173 aa

PF04756OST3_OST6116-163 aa

PF31212AvrRxo1-ORF2178-195 aa

PF11240DUF3042189-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G137590	`PF31212`	AvrRxo1-ORF2	16	53	0.51	10.9
TkA03G137590	`PF15944`	DUF4752	18	54	0.23	12.1
TkA03G137590	`PF11240`	DUF3042	18	30	0.39	11.3
TkA03G137590	`PF00085`	Thioredoxin	88	173	3.4e-07	30.9
TkA03G137590	`PF04756`	OST3_OST6	116	163	0.36	10.9
TkA03G137590	`PF31212`	AvrRxo1-ORF2	178	195	0.51	10.9
TkA03G137590	`PF11240`	DUF3042	189	218	0.39	11.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LCV1`	Arabidopsis thaliana	sp\|Q8LCV1\|PLP3B_ARATH Thioredoxin domain-containing protein PLP3B	78.700%	Swiss-Prot	High
`Q6NPL9`	Arabidopsis thaliana	sp\|Q6NPL9\|PLP3A_ARATH Thioredoxin domain-containing protein PLP3A	73.900%	Swiss-Prot	High
`O64628`	Arabidopsis thaliana	sp\|O64628\|TXND9_ARATH Thioredoxin domain-containing protein 9 homolog	40.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card