TkA03G133530 | RubberDandelionOmics

Gene overview

TkA03G133530

Reference: TK1151 Chr: Chr03 Coordinates: 34240587-34245242 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3364 bp · TkA03G133530|TK1151|cDNA

AAAAAAGGTTGAAAGAATTTCCACTTTCTCCTTTCTCTGCCTATAAAAACACTCCATTTCCACACTTGTCTTCTCATCTCTATCCCTTCCGTTCACCCCCTTTTCTCATTCTCCATCGTCAATTACGTCCCCTTCGCTGTTGAAAATTAAGTAAAAAGTTGCGAATCCTTCTGATTTTGTAATCAAGTAGTTTTGTGGCCGATCATGCCGGAAAAAGTTCTCACCCGTGTTCACAGTCTTCGAGAGCGTCTGGACTCTAC...

CDS

Download CDS FASTA

2418 bp · TkA03G133530|TK1151|CDS

ATGCCGGAAAAAGTTCTCACCCGTGTTCACAGTCTTCGAGAGCGTCTGGACTCTACCCTCGCAACTTATCGTAATGAAATCCTAATGGTTCTTTCAAGGATCGAGAGCCATGGAAAAGGAATATTGAAGCCTCACCAACTCATGGCTGAGTTTGATGCAATCTGTAAGGAGGATACCAAACTCCTCAATGGTGCCTTTCACGAAGTTCTCAAATCCACACAGGAAGCAATAGTCCTGTCTCCATGGGTTGCACTTGCTAT...

Protein

Download Protein FASTA

805 aa · TkA03G133530|TK1151|PROTEIN

MPEKVLTRVHSLRERLDSTLATYRNEILMVLSRIESHGKGILKPHQLMAEFDAICKEDTKLLNGAFHEVLKSTQEAIVLSPWVALAIRLRPGVWEYVRVNVNALIVEELTVPEYLHFKEELVNGSSSGNFVLELDFEPFTSSFPRPTLTKYIGNGVEFLNRHLSAKMFHDKDSLHPLLDFLRTHATKGKTMMLNDRIQNLNALQSVLRKASEYLSTLDAATPFSEFEHKFQEIGLERGWGAKAEGVMEMIHMLLDLLEAP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G133530`
TK1151 ID	TkA03G133530
OH-1004 ID	LXL04_002278
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G133530`
Location	Chr03:34240587-34245242 (+)
Description	Similar to Sucrose synthase isoform 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002278` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005985 sucrose metabolic process Biological Process GO:0016157 sucrose synthase activity Molecular Function
KEGG gene cross-reference	sly:543961 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.627

Rank 1 · TkA03G133530 · TK1151

Nucleus0.258

Rank 2 · TkA03G133530 · TK1151

Peroxisome0.101

Rank 3 · TkA03G133530 · TK1151

Mitochondrion0.086

Rank 4 · TkA03G133530 · TK1151

Endoplasmic reticulum0.073

Rank 5 · TkA03G133530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24861SUS_N8-119 aa

PF24862SUS_EPBD21-37 aa

PF24862SUS_EPBD154-240 aa

PF24861SUS_N177-212 aa

PF00862GT-B_Sucrose_synth264-552 aa

PF08222HTH_CodY414-439 aa

PF00534Glycos_transf_1564-728 aa

PF20706GT4-conflict567-702 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G133530	`PF24861`	SUS_N	8	119	6.2e-45	152.8
TkA03G133530	`PF24862`	SUS_EPBD	21	37	3.8e-32	111.3
TkA03G133530	`PF24862`	SUS_EPBD	154	240	3.8e-32	111.3
TkA03G133530	`PF24861`	SUS_N	177	212	6.2e-45	152.8
TkA03G133530	`PF00862`	GT-B_Sucrose_synth	264	552	4.8e-165	548.2
TkA03G133530	`PF08222`	HTH_CodY	414	439	0.083	13.2
TkA03G133530	`PF00534`	Glycos_transf_1	564	728	3.1e-28	99.2
TkA03G133530	`PF20706`	GT4-conflict	567	702	0.0012	18.6
TkA03G133530	`PF13692`	Glyco_trans_1_4	570	722	1.1e-12	49.2
TkA03G133530	`PF24862`	SUS_EPBD	617	649	3.8e-32	111.3
TkA03G133530	`PF13524`	Glyco_trans_1_2	634	759	0.11	13.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card