TkA03G125590 | RubberDandelionOmics

Gene overview

TkA03G125590

Reference: TK1151 Chr: Chr03 Coordinates: 32236576-32245694 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2491 bp · TkA03G125590|TK1151|cDNA

AACACCCCAATTTTTCAAGTACAAGTACTAACCAACCTTGGTTCAACAACATCTAATAACACATTTGGACATAGCGGAAGCATTATACTAGCAAAGAAAAACCTAGGGGTGGCAAAAGTCGACACGACACGACAAAAATACACGACACGAAACGAAATTGGAACGATTTCAAAATTCAAATTCGTGTTCGTGTCGTGTTCGTGTTATGTAAAAGTAAAACGACGTCGTGTCGTGTCGTGTTCGTGTTCGAAATTTAGAAC...

CDS

Download CDS FASTA

1740 bp · TkA03G125590|TK1151|CDS

ATGAAAAGGGAAAGATCTGATGAAACACATGATACAAATAGGACAAAGCATCATAAAACAAGCACACCTTCTTCACCTGTAGCTCCTCAGGATGTTGAACTTGAAGAATCTGATGGCATTGATGTGGTGGAGGTAGATGTTGAAGTAGAAGGTGAAGATGACGGTGTAAAAGTCGAAAGAGAACGGTGGTCTGAGGTATGGAATTATTTTACCAGACTTCCAATTTGTAAAGATGACAGAGAAAGGGCCGAATGTAATAA...

Protein

Download Protein FASTA

579 aa · TkA03G125590|TK1151|PROTEIN

MKRERSDETHDTNRTKHHKTSTPSSPVAPQDVELEESDGIDVVEVDVEVEGEDDGVKVERERWSEVWNYFTRLPICKDDRERAECNKCKKRYICETKTETGSMKKHIAKCPRRDKTDISQFIFSKSGGSISSSVFKPERFRELISEAIVKHDLPFKFVEYEGIRAIFRYLNEKVITICRNTAKEDVLKLYKREKEKLHKLFEILPGRISLTADLWSSINTDGFLCVTSHFINEEWKLKKRILNFQYMPPPHNGVCLTEIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G125590`
TK1151 ID	TkA03G125590
OH-1004 ID	LXL04_007129
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 98.618 / OH-1004 60.616 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G125590

Location Chr03:32236576-32245694 (-)

Description Similar to Os03g0733400: Zinc finger BED domain-containing protein RICESLEEPER 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0733400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0239150`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0583200`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007129 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0032196 transposition Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

dosa:Os03g0733400

dosa:Os05g0239150

dosa:Os05g0583200

osa:4339741

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.938

Rank 1 · TkA03G125590 · TK1151

Cytoplasm0.120

Rank 2 · TkA03G125590 · TK1151

Mitochondrion0.025

Rank 3 · TkA03G125590 · TK1151

Cell membrane0.015

Rank 4 · TkA03G125590 · TK1151

Extracellular0.010

Rank 5 · TkA03G125590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26295PDDEXK_1727-108 aa

PF02892zf-BED64-109 aa

PF22523DUF6999116-154 aa

PF23302HTH_DNAJC9137-154 aa

PF23302HTH_DNAJC9183-205 aa

PF27041ZBED1_RNase-like211-306 aa

PF26742DUF8247219-271 aa

PF27039ZBED1_RNase-like_helical310-419 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G125590	`PF26295`	PDDEXK_17	27	108	0.32	12.1
TkA03G125590	`PF02892`	zf-BED	64	109	1.6e-05	25.6
TkA03G125590	`PF22523`	DUF6999	116	154	0.015	15.0
TkA03G125590	`PF23302`	HTH_DNAJC9	137	154	0.084	13.8
TkA03G125590	`PF23302`	HTH_DNAJC9	183	205	0.084	13.8
TkA03G125590	`PF27041`	ZBED1_RNase-like	211	306	2.7e-30	105.1
TkA03G125590	`PF26742`	DUF8247	219	271	0.00097	19.8
TkA03G125590	`PF27039`	ZBED1_RNase-like_helical	310	419	6.6e-34	117.0
TkA03G125590	`PF22523`	DUF6999	360	404	0.015	15.0
TkA03G125590	`PF14372`	hAT-like_RNase-H	440	531	1.9e-29	102.4
TkA03G125590	`PF23302`	HTH_DNAJC9	507	528	0.084	13.8
TkA03G125590	`PF27041`	ZBED1_RNase-like	518	546	2.7e-30	105.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AVI0`	Oryza sativa subsp. japonica	sp\|Q6AVI0\|RSLE2_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 2	33.200%	Swiss-Prot	Medium
`B9FJG3`	Oryza sativa subsp. japonica	sp\|B9FJG3\|RSLE1_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 1	33.100%	Swiss-Prot	Medium
`Q75HY5`	Oryza sativa subsp. japonica	sp\|Q75HY5\|RSLE3_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 3	31.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card