TkA03G119960 | RubberDandelionOmics

Gene overview

TkA03G119960

Reference: TK1151 Chr: Chr03 Coordinates: 30650707-30654151 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2882 bp · TkA03G119960|TK1151|cDNA

GTTATTACAAACATAGAACTTTTAAATGAATTAATTTTAAAAACAAATTTACTAAAATACAATTACTAAAAGTAAATTAGTAAAATGTAAAATGTTTTTCACACTTTTACAGTCGACAATAGCTCCAAATTTATTGGTAATTTTGTCTTTTCCCAACCCACATTTATGTGGACAGATATGATCAACCGACAAACTTGGAGGTCGGCAGCTGTCGGCCGGTGACGGGGGAGTTGAAACCGGGAAGATCCGTATAACTTCTC...

CDS

Download CDS FASTA

708 bp · TkA03G119960|TK1151|CDS

ATGGATGTCAACTACTGGAACCTGTCCTTTTCGGAAGCGGAATCTGGGAATAATACGAATTTGGTTGAAAATTTGGGATGTGGGGATTATGAGGGAGATGGAGATGAGATTGTTCCGGAACATTTTTTGACGGTTTTGGACATGGGGGGTGAGAGGGAGAAACTTAAAGTTGTGGGGCAAATACGTCATTTGTCGAAAGATGATGACGAGGCGCGGGTTTTTATGGGTGAGAATGGTGTTGTTGAAGGTTTGATGCGGTT...

Protein

Download Protein FASTA

235 aa · TkA03G119960|TK1151|PROTEIN

MDVNYWNLSFSEAESGNNTNLVENLGCGDYEGDGDEIVPEHFLTVLDMGGEREKLKVVGQIRHLSKDDDEARVFMGENGVVEGLMRFFESSVFEGNVIAQESVAMALFNLSVNNNRNKETMVACGVLPLLEEMIKTSSSPSAVAALYLNLSSLDQAKPIIGSTTAIPFLIHILETESESDPESESKSDALHPVPPLNPPPQHPPPNPLQPPLRPHPAARIPNMDRESHSRVDQHG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G119960`
TK1151 ID	TkA03G119960
OH-1004 ID	LXL04_025769
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.400
Protein coverage (%)	TK1151 81.277 / OH-1004 25.365 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G119960

Location Chr03:30650707-30654151 (-)

Description Similar to PUB45: U-box domain-containing protein 45

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g27910`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At1g67530`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At1g24330`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025769 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050777 negative regulation of immune response Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

GO:0070696 transmembrane receptor protein serine/threonine kinase binding Molecular Function

KEGG gene cross-reference

ath:AT1G24330

ath:AT1G27910

ath:AT1G67530

ath:AT2G28830

ath:AT3G46510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.517

Rank 1 · TkA03G119960 · TK1151

Nucleus0.505

Rank 2 · TkA03G119960 · TK1151

Cell membrane0.066

Rank 3 · TkA03G119960 · TK1151

Endoplasmic reticulum0.057

Rank 4 · TkA03G119960 · TK1151

Mitochondrion0.044

Rank 5 · TkA03G119960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25598ARM_PUB43-139 aa

PF24768ARM_ARMC557-185 aa

PF00514Arm69-91 aa

PF05804KAP72-174 aa

PF08324PUL79-136 aa

PF00514Arm114-141 aa

PF08324PUL142-182 aa

PF00514Arm165-179 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G119960	`PF25598`	ARM_PUB	43	139	0.00038	20.7
TkA03G119960	`PF24768`	ARM_ARMC5	57	185	9.4e-05	22.6
TkA03G119960	`PF00514`	Arm	69	91	0.00042	21.0
TkA03G119960	`PF05804`	KAP	72	174	0.00047	19.2
TkA03G119960	`PF08324`	PUL	79	136	0.041	13.9
TkA03G119960	`PF00514`	Arm	114	141	0.00042	21.0
TkA03G119960	`PF08324`	PUL	142	182	0.041	13.9
TkA03G119960	`PF00514`	Arm	165	179	0.00042	21.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7G1`	Arabidopsis thaliana	sp\|Q9C7G1\|PUB45_ARATH U-box domain-containing protein 45	42.900%	Swiss-Prot	Medium
`Q9CAG5`	Arabidopsis thaliana	sp\|Q9CAG5\|PUB7_ARATH U-box domain-containing protein 7	52.100%	Swiss-Prot	Medium
`O48700`	Arabidopsis thaliana	sp\|O48700\|PUB6_ARATH U-box domain-containing protein 6	48.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card