Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1813 bp · TkA03G105770|TK1151|cDNA
ATATATACAGACCAAATTTGTAATTTTGGTGAAGACCTTTTCACGACTCTCGTGACCAATCAAGTACGTGGGTCCAAAAGAGTATAAGAAATTAAAGGCTGTCGATACTAACAATACCCACCAGTCATCAAGACTTCCATACACTTTGTCCAGCAATTCCCAAATTTACAATTTTAACCCTCCCACCCCTCAACTAAAGCTTCTTCTTCACTCCCAGAACTTCAAACTCATTTTATCCAAATTTTCCAGTTATATTCAAA...
1458 bp · TkA03G105770|TK1151|CDS
ATGGAATCCTTACAGCCATTTCCAACCGAAAACGACCTGTCAGAAGCTCGAAAAACCGTACGAGATCTCGCAATCAAGATCGAAAAATCAAACTCGAGAGCTCAAAAACACAAAAAACAAGAAGAAAAACAGGAGGATTCTCAGTACACACAAGTAATGAAAGAAATTGAAACCATGAAACAAGAATTGGGGAAACTGAAGCTCGATATGAAACATGTTTTGAAGGAGAAAAAACATACGGAAAATGGATTCAAAGCCTC...
Protein
Download Protein FASTA485 aa · TkA03G105770|TK1151|PROTEIN
MESLQPFPTENDLSEARKTVRDLAIKIEKSNSRAQKHKKQEEKQEDSQYTQVMKEIETMKQELGKLKLDMKHVLKEKKHTENGFKASSSKSSMLSSAVERIKKEIEELDEEQVLVEIARIEAVKELEAIEAQKKEEAIRYQIQLEEIKKKTEQIIQQKASNVNMNSTRDLLHKMNAEKEALEAELEEIKGEGFNLMASMDVIRNELKAMQEEMSRLEKEEEKRDLTIETLNAKILKGKLKLESVTSTTEKANSIASNLSI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G105770 |
|---|---|
| TK1151 ID | TkA03G105770 |
| OH-1004 ID | LXL04_007049 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 98.400 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G105770 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:27084110-27086117 (-) | |||||||||
| Description | Similar to PMI2: Protein PLASTID MOVEMENT IMPAIRED 2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0007155 cell adhesion Biological Process GO:0009408 response to heat Biological Process GO:0009637 response to blue light Biological Process GO:0009888 tissue development Biological Process GO:0009903 chloroplast avoidance movement Biological Process GO:0009904 chloroplast accumulation movement Biological Process GO:0016477 cell migration Biological Process GO:0040017 positive regulation of locomotion Biological Process GO:0042127 regulation of cell population proliferation Biological Process GO:0051788 response to misfolded protein Biological Process GO:0071260 cellular response to mechanical stimulus Biological Process GO:0071711 basement membrane organization Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G66840 ath:AT5G55860 cel:CELE_K08C7.3 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF24161CCDC3911-165 aaPF05701WEMBL18-177 aaPF10473CENP-F_leu_zip20-128 aaPF24845DUF772133-93 aaPF10473CENP-F_leu_zip75-157 aaPF24845DUF772185-113 aaPF24161CCDC39145-316 aaPF05701WEMBL152-401 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G105770 | PF24161 | CCDC39 | 11 | 165 | 9.3 | 4.7 |
| TkA03G105770 | PF05701 | WEMBL | 18 | 177 | 6.4e-14 | 52.3 |
| TkA03G105770 | PF10473 | CENP-F_leu_zip | 20 | 128 | 0.71 | 10.6 |
| TkA03G105770 | PF24845 | DUF7721 | 33 | 93 | 3.2 | 9.2 |
| TkA03G105770 | PF10473 | CENP-F_leu_zip | 75 | 157 | 0.71 | 10.6 |
| TkA03G105770 | PF24845 | DUF7721 | 85 | 113 | 3.2 | 9.2 |
| TkA03G105770 | PF24161 | CCDC39 | 145 | 316 | 9.3 | 4.7 |
| TkA03G105770 | PF05701 | WEMBL | 152 | 401 | 6.4e-14 | 52.3 |
| TkA03G105770 | PF10473 | CENP-F_leu_zip | 171 | 232 | 0.71 | 10.6 |
| TkA03G105770 | PF10473 | CENP-F_leu_zip | 250 | 322 | 0.71 | 10.6 |
| TkA03G105770 | PF24161 | CCDC39 | 380 | 399 | 9.3 | 4.7 |
| TkA03G105770 | PF10473 | CENP-F_leu_zip | 381 | 403 | 0.71 | 10.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.