TkA03G103720 | RubberDandelionOmics

Gene overview

TkA03G103720

Reference: TK1151 Chr: Chr03 Coordinates: 26517843-26520302 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1533 bp · TkA03G103720|TK1151|cDNA

TTCTAACGGGAAACGGAATGAATGAACGTGGGATAAAGGTGATGATGATAGGAAGAAAAAACCCGCTTTTCATCACCATTGAATTTCACCTTCCCACCAGCGATGAATAAAGGATTCAAGACGAGGGAGATTAGGGTTTTGTTGTTATTTAAATCAACACCCAATTAAAAAATGAATATGCAATCGATTAGAAGAACAACATTGTTGTAACAAGCCACTCAATCGATTGCTTCAATCTAAAGCTGCAATTCTCATGAAAC...

CDS

Download CDS FASTA

798 bp · TkA03G103720|TK1151|CDS

ATGACGGATCATTTTGTGTTGCTGGTTGATCGTTTGCTCACTGAATCCTCTCTTGAAGCTGTTATCGAGAGTGAAAATCGATTGCTTAATCCGACCATCATCAATTCAGTAAACGAAGAAATGGTTACTGATGTTTCTTCTCATAGGATGGATCTCACTTTTGAATCAAATCCAAAGAAATTGGTGGAATGCAGGATTTGCCATGACGATGATGAAGACTCGAAAATGGAGACACCATGTTCATGTCGTGGCAGCTTGAA...

Protein

Download Protein FASTA

265 aa · TkA03G103720|TK1151|PROTEIN

MTDHFVLLVDRLLTESSLEAVIESENRLLNPTIINSVNEEMVTDVSSHRMDLTFESNPKKLVECRICHDDDEDSKMETPCSCRGSLKFAHRICVQRWCNEKGNTTCEICLQPFNPGYTSPPPSPQCDGNLINFRGNWEISRNDLYNLRFSSMVSSSHEEPDFDDYIAPSPGSLTCCRVVAVMFMTLLVLRHTLPIIINGAGGYTATMFTLIMLRCIGVMLPIYIMFRAFSVVQRGLQLEDYRYFRSDEENDLAQSSSDLR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G103720`
TK1151 ID	TkA03G103720
OH-1004 ID	LXL04_007018
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G103720`
Location	Chr03:26517843-26520302 (+)
Description	Similar to SUD1: Probable E3 ubiquitin ligase SUD1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_007018` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000209 protein polyubiquitination Biological Process GO:0002495 antigen processing and presentation of peptide antigen via MHC class II Biological Process GO:0006955 immune response Biological Process GO:0008299 isoprenoid biosynthetic process Biological Process GO:0009414 response to water deprivation Biological Process GO:0010025 wax biosynthetic process Biological Process GO:0010143 cutin biosynthetic process Biological Process GO:0010345 suberin biosynthetic process Biological Process GO:0016567 protein ubiquitination Biological Process GO:0036503 ERAD pathway Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0045347 negative regulation of MHC class II biosynthetic process Biological Process
KEGG gene cross-reference	ath:AT4G34100 hsa:441061 mmu:211147 mmu:71779 rno:499558 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.316

Rank 1 · TkA03G103720 · TK1151

Endoplasmic reticulum0.239

Rank 2 · TkA03G103720 · TK1151

Cell membrane0.216

Rank 3 · TkA03G103720 · TK1151

Cytoplasm0.207

Rank 4 · TkA03G103720 · TK1151

Golgi apparatus0.163

Rank 5 · TkA03G103720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05290Baculo_IE-117-113 aa

PF05886Orthopox_F860-117 aa

PF13639zf-RING_263-109 aa

PF12906RINGv64-109 aa

PF13639zf-RING_2105-118 aa

PF12428DUF3675115-228 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G103720	`PF05290`	Baculo_IE-1	17	113	0.014	16.1
TkA03G103720	`PF05886`	Orthopox_F8	60	117	0.29	12.0
TkA03G103720	`PF13639`	zf-RING_2	63	109	1.0	10.4
TkA03G103720	`PF12906`	RINGv	64	109	2.9e-14	53.6
TkA03G103720	`PF13639`	zf-RING_2	105	118	1.0	10.4
TkA03G103720	`PF12428`	DUF3675	115	228	4e-35	121.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card