Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1717 bp · TkA03G103600|TK1151|cDNA
CAGCCCCCAACACCATAATTCAATCGTCTGCGGCATTAAATGTGATTAGCTCCACATTTTTTTCTTTATTCATATTCTTCATACACACATTGCTCTCAAGATTCTTCCATCTGTAAGTCCCATGTGTATTTGGCACATGTTTATACGAAATTCTGTTCTTTGATTCTCAATAATTAGAGGGTTCTTTTGGAAATTCGATTTGTTATCAGTTACAATATAAAATTCGAACTTTGAATCTTGGATCTCATAACTCTATCTTA...
1353 bp · TkA03G103600|TK1151|CDS
ATGGGGTTCTTCGAATCAGACGTTAAATTTGGTCAACAAGAACTGATTTACGCTGTTGTGCCATTACTAAAGCTCTTGTCTCTTACAGTCATCGGTATTCTTCTTGCACACCCAAGAACACAAATCGTCCCAAAATCTACTTTCAAGCTACTTAGCAAACTCGTTTTTGCCCTGTTTTTACCCTGCACGATCTTTATTCACCTGGGTGAATCAATTTCATTGAAGAATTTAACTTTATGGTGGTTCATACCCGTAAACGT...
Protein
Download Protein FASTA450 aa · TkA03G103600|TK1151|PROTEIN
MGFFESDVKFGQQELIYAVVPLLKLLSLTVIGILLAHPRTQIVPKSTFKLLSKLVFALFLPCTIFIHLGESISLKNLTLWWFIPVNVIISTAIGCVLGLLVALICRPPPEFFRFTVIVTGFGNTGNLILAIVGSICHSGDNSFGPDCHTTGTAYVSLAQWVSVLLVYTLVYHMMEPPMEYYEVVEEDGEIEIVQENLPANDLSRPLLHEAEWPGMEDKETEHCKTPFIARVFASDFSQTSIPDPDSLEDGHEQPQSPKSI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G103600 |
|---|---|
| TK1151 ID | TkA03G103600 |
| OH-1004 ID | LXL04_007017 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 99.800 |
| Protein coverage (%) | TK1151 99.556 / OH-1004 55.446Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G103600 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:26481111-26486568 (+) | |||||||||
| Description | Similar to PILS2: Protein PIN-LIKES 2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0009733 response to auxin Biological Process GO:0009734 auxin-activated signaling pathway Biological Process GO:0010311 lateral root formation Biological Process GO:0040009 regulation of growth rate Biological Process GO:0080162 endoplasmic reticulum to cytosol auxin transport Biological Process GO:0140964 intracellular auxin homeostasis Biological Process GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0010329 auxin efflux transmembrane transporter activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G71090 ath:AT2G17500 ath:AT5G01990 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF03547Mem_trans18-438 aaPF11393T4BSS_DotI_IcmL88-114 aaPF11393T4BSS_DotI_IcmL161-193 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G103600 | PF03547 | Mem_trans | 18 | 438 | 5.8e-87 | 292.2 |
| TkA03G103600 | PF11393 | T4BSS_DotI_IcmL | 88 | 114 | 0.29 | 11.3 |
| TkA03G103600 | PF11393 | T4BSS_DotI_IcmL | 161 | 193 | 0.29 | 11.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.