TkA03G085980 | RubberDandelionOmics

Gene overview

TkA03G085980

Reference: TK1151 Chr: Chr03 Coordinates: 21908017-21910850 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1468 bp · TkA03G085980|TK1151|cDNA

TTTTGACCCGTGCCGCCGTGCGTGCGGGACTATTGATTATTCGCGTGGACCACGCGCTCCCAAACCAGCAACTCCTCTGTGATCCACCCTAAATTTGTGTAGAGCGATTGGATTGTGAATGCCAGTTATGAAACATCCCGTCATTTCAATCTCCTCCTCTTCCGACGACGACGATAATGGAATCTTCGAAGAAGAAGACCTAGAATCGGAATTTTCGTCGCAAGACGACAGCGATTATAGCGAATCGGACGATCAGGAGT...

CDS

Download CDS FASTA

1095 bp · TkA03G085980|TK1151|CDS

ATGCCAGTTATGAAACATCCCGTCATTTCAATCTCCTCCTCTTCCGACGACGACGATAATGGAATCTTCGAAGAAGAAGACCTAGAATCGGAATTTTCGTCGCAAGACGACAGCGATTATAGCGAATCGGACGATCAGGAGTACGACGAGGAGGAAGAAAATGATCCTGAGTCTGATGAAGAAGAATGTTTTGATAATCAAGGAAGTAATGATGAAAAAGAGCTAAGTCTTGTAGAATGTAAAGCATACTTGAGGAAGCA...

Protein

Download Protein FASTA

364 aa · TkA03G085980|TK1151|PROTEIN

MPVMKHPVISISSSSDDDDNGIFEEEDLESEFSSQDDSDYSESDDQEYDEEEENDPESDEEECFDNQGSNDEKELSLVECKAYLRKHKLRLSGTKEECRQRIKEHERLKEVGGESIYPRSSFSVNCTGDACKGDVVLFKQKIQNKFDKGGNRGNVMGKRTVAGRIVKESYGASKQQHTFTVEVLWNKGWKRLPVLSTLLVKGRNLYRYGTFRQAWKSEAERSKVLEEKHKRGEAARHIRKSYKTQISSNYNNNNKRKLNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G085980`
TK1151 ID	TkA03G085980
OH-1004 ID	LXL04_006887
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G085980

Location Chr03:21908017-21910850 (-)

Description Similar to Os10g0391300: Zinc finger CCCH domain-containing protein 62

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0391300`	Zinc finger CCCH domain-containing protein 62.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006887 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

dosa:Os10g0391300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.915

Rank 1 · TkA03G085980 · TK1151

Cytoplasm0.200

Rank 2 · TkA03G085980 · TK1151

Mitochondrion0.022

Rank 3 · TkA03G085980 · TK1151

Cell membrane0.019

Rank 4 · TkA03G085980 · TK1151

Endoplasmic reticulum0.012

Rank 5 · TkA03G085980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15806TRAPP14_N41-104 aa

PF02037SAP74-107 aa

PF21422NP_C_Orthomyx115-175 aa

PF24766DUF7699131-215 aa

PF24766DUF7699238-274 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G085980	`PF15806`	TRAPP14_N	41	104	1.1	9.2
TkA03G085980	`PF02037`	SAP	74	107	2.1e-07	31.1
TkA03G085980	`PF21422`	NP_C_Orthomyx	115	175	0.11	12.5
TkA03G085980	`PF24766`	DUF7699	131	215	1.3e-38	132.2
TkA03G085980	`PF24766`	DUF7699	238	274	1.3e-38	132.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q338N2`	Oryza sativa subsp. japonica	sp\|Q338N2\|C3H62_ORYSJ Zinc finger CCCH domain-containing protein 62	49.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card