TkA03G083130 | RubberDandelionOmics

Gene overview

TkA03G083130

Reference: TK1151 Chr: Chr03 Coordinates: 21204751-21214015 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1385 bp · TkA03G083130|TK1151|cDNA

CTCAAATTCCCCCTATCCCCTATACCACCTGCACAAATCATTGTAGTGTTTGTATTACGACTTCCAAATGACAACCCAAATCACAACGACAAATCCCATTGGTCACCGGCCTCCAAATACCGGAGATCTCATAACCGTACTTTCTATTGATGGTGGAGGCATCCGAGGTATCGTCCCTGGTGTCATTCTCGAGTACCTTGAATTACAACTTCAGGAGTTAGACGGAGAGGAAGCAAGAATAGCGGATTACTTTGACGTGA...

CDS

Download CDS FASTA

1215 bp · TkA03G083130|TK1151|CDS

ATGACAACCCAAATCACAACGACAAATCCCATTGGTCACCGGCCTCCAAATACCGGAGATCTCATAACCGTACTTTCTATTGATGGTGGAGGCATCCGAGGTATCGTCCCTGGTGTCATTCTCGAGTACCTTGAATTACAACTTCAGGAGTTAGACGGAGAGGAAGCAAGAATAGCGGATTACTTTGACGTGATCGCTGGAACAAGTACAGGAGGTTTAGTAACCGTCATGTTAACGGCTCCAGACGAAAACAACAAACC...

Protein

Download Protein FASTA

404 aa · TkA03G083130|TK1151|PROTEIN

MTTQITTTNPIGHRPPNTGDLITVLSIDGGGIRGIVPGVILEYLELQLQELDGEEARIADYFDVIAGTSTGGLVTVMLTAPDENNKPLYAAKDIVPFYLENCPKIFKQIGGPFAGIIKLLKSLLGPKYDGKYLKTLVTGLLGTTKLSQTLTNVVIPTFDIRDMQPVVFSSYQVPREPSTDALLSDICMGTSAAPTYLPAYYFQNGDREFNLVDGGVAANNPSLVAVGEVTRQVMKGDPNFVPITPLDYGRYLLISLGTGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G083130`
TK1151 ID	TkA03G083130
OH-1004 ID	LXL04_006865
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G083130

Location Chr03:21204751-21214015 (-)

Description Similar to PLP2: Patatin-like protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g37070`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	No verified direct reference in this release
`At2g26560`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	A pathogen-inducible patatin-like lipid acyl hydrolase facilitates fungal and bacterial host colonization in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02578.x The Arabidopsis patatin-like protein 2 (PLP2) plays an essential role in cell death execution and differentially affects biosynthesis of oxylipins and resistance to pathogens.2009 · DOI: 10.1094/mpmi-22-4-0469
`At4g37060`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	No verified direct reference in this release
`At4g37050`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YW91`	Possesses non-specific lipolytic acyl hydrolase (LAH) activity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006865 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010311 lateral root formation Biological Process

GO:0012501 programmed cell death Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0031408 oxylipin biosynthetic process Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0051607 defense response to virus Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G26560

ath:AT4G37050

ath:AT4G37060

ath:AT4G37070

dosa:Os08g0477500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.434

Rank 1 · TkA03G083130 · TK1151

Cell membrane0.183

Rank 2 · TkA03G083130 · TK1151

Nucleus0.151

Rank 3 · TkA03G083130 · TK1151

Plastid0.122

Rank 4 · TkA03G083130 · TK1151

Mitochondrion0.102

Rank 5 · TkA03G083130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01734Patatin25-225 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G083130	`PF01734`	Patatin	25	225	2.9e-26	93.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23179`	Arabidopsis thaliana	sp\|O23179\|PLP1_ARATH Patatin-like protein 1	58.000%	Swiss-Prot	High
`O48723`	Arabidopsis thaliana	sp\|O48723\|PLP2_ARATH Patatin-like protein 2	59.600%	Swiss-Prot	High
`O23180`	Arabidopsis thaliana	sp\|O23180\|PLP5_ARATH Patatin-like protein 5	58.000%	Swiss-Prot	High
`O23181`	Arabidopsis thaliana	sp\|O23181\|PLP3_ARATH Patatin-like protein 3	55.800%	Swiss-Prot	High
`A2YW91`	Oryza sativa subsp. indica	sp\|A2YW91\|PLP2_ORYSI Patatin-like protein 2	52.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card