TkA03G075260 | RubberDandelionOmics

Gene overview

TkA03G075260

Reference: TK1151 Chr: Chr03 Coordinates: 19308822-19311735 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1839 bp · TkA03G075260|TK1151|cDNA

ATGACAAGTAAGTGTCGTTGCGCTTCCTTATATAGTGAAGAAGAAGGGGACAGCACAGGCCAATTCCACCTCCACAACGGTCAATCTTCAAATACCGCCTCTCAACATCAAATTAGATCGGGAAAATTATCCCTTTGGCGATCCACAGTCGTTTCCGCCCTAGAGACATTCGATTTGGAGTCATTCATCTTCAATCCCACTCCACCAACAGATACATATGTCTCCAGCGATTCTGAAGACGACGAACCTTCGGCTCCTAA...

CDS

Download CDS FASTA

1839 bp · TkA03G075260|TK1151|CDS

ATGACAAGTAAGTGTCGTTGCGCTTCCTTATATAGTGAAGAAGAAGGGGACAGCACAGGCCAATTCCACCTCCACAACGGTCAATCTTCAAATACCGCCTCTCAACATCAAATTAGATCGGGAAAATTATCCCTTTGGCGATCCACAGTCGTTTCCGCCCTAGAGACATTCGATTTGGAGTCATTCATCTTCAATCCCACTCCACCAACAGATACATATGTCTCCAGCGATTCTGAAGACGACGAACCTTCGGCTCCTAA...

Protein

Download Protein FASTA

612 aa · TkA03G075260|TK1151|PROTEIN

MTSKCRCASLYSEEEGDSTGQFHLHNGQSSNTASQHQIRSGKLSLWRSTVVSALETFDLESFIFNPTPPTDTYVSSDSEDDEPSAPKPDPDYASWKKKDRFVLLWIKSPLSKRALSLIVRATSSYTAWTTLEKSFQSQTRARRMAMKVQLQQLTKGSLSMMEYLDRKRSIADSLAENLSPLSDEDLIGYILTGLDSSYNVFTTAFMMKSDVTVDDLVGFLLQEEARLEHDHTRHPLFSAPPLPLHPALPSYPTPKSRDSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G075260`
TK1151 ID	TkA03G075260
OH-1004 ID	LXL04_019813
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	56.100
Protein coverage (%)	TK1151 90.196 / OH-1004 30.820 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G075260

Location Chr03:19308822-19311735 (-)

Description Similar to BMY1: Beta-amylase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`UniProt: Q94HW2`	Retrovirus-related Pol polyprotein from transposon RE1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019813 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005983 starch catabolic process Biological Process

GO:0080027 response to herbivore Biological Process

GO:0005576 extracellular region Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0016161 beta-amylase activity Molecular Function

KEGG gene cross-reference

ath:AT4G15210

gmx:547931

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.596

Rank 1 · TkA03G075260 · TK1151

Cytoplasm0.511

Rank 2 · TkA03G075260 · TK1151

Mitochondrion0.057

Rank 3 · TkA03G075260 · TK1151

Peroxisome0.031

Rank 4 · TkA03G075260 · TK1151

Endoplasmic reticulum0.025

Rank 5 · TkA03G075260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223Retrotran_gag_279-231 aa

PF29444KH_FAR1_2nd165-201 aa

PF22936Pol_BBD279-352 aa

PF13976gag_pre-integrs319-330 aa

PF13976gag_pre-integrs384-450 aa

PF00665rve467-561 aa

PF22936Pol_BBD506-529 aa

PF29688TnsB_C535-577 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G075260	`PF14223`	Retrotran_gag_2	79	231	7.7e-22	78.5
TkA03G075260	`PF29444`	KH_FAR1_2nd	165	201	0.077	13.6
TkA03G075260	`PF22936`	Pol_BBD	279	352	3.4e-10	40.8
TkA03G075260	`PF13976`	gag_pre-integrs	319	330	1.3e-11	44.8
TkA03G075260	`PF13976`	gag_pre-integrs	384	450	1.3e-11	44.8
TkA03G075260	`PF00665`	rve	467	561	7.6e-10	39.7
TkA03G075260	`PF22936`	Pol_BBD	506	529	3.4e-10	40.8
TkA03G075260	`PF29688`	TnsB_C	535	577	0.3	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZT94`	Arabidopsis thaliana	sp\|Q9ZT94\|POLR2_ARATH Retrovirus-related Pol polyprotein from transposon RE2	38.000%	Swiss-Prot	Medium
`Q94HW2`	Arabidopsis thaliana	sp\|Q94HW2\|POLR1_ARATH Retrovirus-related Pol polyprotein from transposon RE1	37.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card