Gene Card
Gene overview
cDNA / CDS / Protein Sequences
582 bp · TkA03G065470|TK1151|cDNA
ATGCTACTTCACGGGAACTTCTCCCTTCCATTCCGATCACCCCTCCGCCTACGAGTACGACCTCCGATCACCCACCACCACCACCCACGCAAACTCTCATTCGCAGCAATTTCATCTTCCGCCGGTTTTGCCATCTCCGACCAAGAGCTGGAATCGCGAGGCTTCATCTTCCGCCGCACAATCGAAGACCTGAACTTAGACCACTTAAACTCCGTCTTTGTCGCCGTCGGTTTCCCAAAACGAGACACCGACAAGATAAA...
582 bp · TkA03G065470|TK1151|CDS
ATGCTACTTCACGGGAACTTCTCCCTTCCATTCCGATCACCCCTCCGCCTACGAGTACGACCTCCGATCACCCACCACCACCACCCACGCAAACTCTCATTCGCAGCAATTTCATCTTCCGCCGGTTTTGCCATCTCCGACCAAGAGCTGGAATCGCGAGGCTTCATCTTCCGCCGCACAATCGAAGACCTGAACTTAGACCACTTAAACTCCGTCTTTGTCGCCGTCGGTTTCCCAAAACGAGACACCGACAAGATAAA...
Protein
Download Protein FASTA193 aa · TkA03G065470|TK1151|PROTEIN
MLLHGNFSLPFRSPLRLRVRPPITHHHHPRKLSFAAISSSAGFAISDQELESRGFIFRRTIEDLNLDHLNSVFVAVGFPKRDTDKIKVALEHTDSLLWVEYEKTKRPVAFARATGDGVFNAIIWDVVVDPTFQGIGLGKAVIERVVEELLEKGIINIALYSEPRVLGFYRPLGFVSDPEGIRGMVYSRKNKKK
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G065470 |
|---|---|
| TK1151 ID | TkA03G065470 |
| OH-1004 ID | LXL04_006734 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 56.433Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G065470 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:16815694-16816275 (+) | ||||||||||||
| Description | Similar to SNAT2: Serotonin N-acetyltransferase 2, chloroplastic | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006474 N-terminal protein amino acid acetylation Biological Process GO:0018394 peptidyl-lysine acetylation Biological Process GO:0030187 melatonin biosynthetic process Biological Process GO:2000028 regulation of photoperiodism, flowering Biological Process GO:0005737 cytoplasm Cellular Component GO:0009507 chloroplast Cellular Component GO:0004059 aralkylamine N-acetyltransferase activity Molecular Function GO:0008080 N-acetyltransferase activity Molecular Function GO:0046982 protein heterodimerization activity Molecular Function GO:0061733 protein-lysine-acetyltransferase activity Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT1G26220 dosa:Os08g0102000 syn:sll0286 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00583Acetyltransf_182-174 aaPF13673Acetyltransf_1089-176 aaPF13508Acetyltransf_795-175 aaPF14542Acetyltransf_CG120-154 aaPF13527Acetyltransf_9121-174 aaPF08445FR47122-174 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G065470 | PF00583 | Acetyltransf_1 | 82 | 174 | 1.5e-12 | 48.5 |
| TkA03G065470 | PF13673 | Acetyltransf_10 | 89 | 176 | 5.7e-07 | 30.3 |
| TkA03G065470 | PF13508 | Acetyltransf_7 | 95 | 175 | 1.3e-09 | 39.0 |
| TkA03G065470 | PF14542 | Acetyltransf_CG | 120 | 154 | 0.0092 | 16.8 |
| TkA03G065470 | PF13527 | Acetyltransf_9 | 121 | 174 | 0.11 | 13.2 |
| TkA03G065470 | PF08445 | FR47 | 122 | 174 | 0.0014 | 19.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.