TkA03G058080 | RubberDandelionOmics

Gene overview

TkA03G058080

Reference: TK1151 Chr: Chr03 Coordinates: 14969046-14973232 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2098 bp · TkA03G058080|TK1151|cDNA

CAAAAATGAGGTCTAAATTCGAACAGGTAATCTCAATGAACATAACTAGCACAACTGGAAATATGAAATTCCCTTCAAAATTAAAACTAACAAAGAACATCAAGTGCAACATTCATCCCATGAAGTACAATAAATTAAAACTTTTCACTCGAAGATTTAATCTCAATTCATCTAAAATGTGTGCTATAATACTTGTAAACAATTTCAGTTTGATCTAAAACACTTTGAAAACTGAGGAAATCAGCAAACGAGTTACAAAA...

CDS

Download CDS FASTA

387 bp · TkA03G058080|TK1151|CDS

ATGGTGTTTGGTCAGGTGGTAATCGGTCCCCCGGGTTCCGGCAAGACCACTTACTGCAATGGCATGTCACAGTACCTTCAACTCATTGGGAGGAAAGTAGCTGTAATTAACTTAGACCCTGCAAATGATTCATTACCATATGACTGTGCTATCAACATCGAGGATCTTATAAAACTCAGCGATGTGATGAATGAACATTCTCTTGGTCCTAATGGAGGTCTAGTCTATTGTATGGATTACTTGGAGAAAAATATCGATTG...

Protein

Download Protein FASTA

128 aa · TkA03G058080|TK1151|PROTEIN

MVFGQVVIGPPGSGKTTYCNGMSQYLQLIGRKVAVINLDPANDSLPYDCAINIEDLIKLSDVMNEHSLGPNGGLVYCMDYLEKNIDWLESKLKPLLKDHYFLFDFPGQVELFFLILMQKSHHATYQKA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G058080`
TK1151 ID	TkA03G058080
OH-1004 ID	LXL04_015272
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.400
Protein coverage (%)	TK1151 89.062 / OH-1004 24.359 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G058080

Location Chr03:14969046-14973232 (+)

Description Similar to QQT1: GPN-loop GTPase QQT1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22370`	Small GTPase that is essential for the correct formation of the tangential divisions in early embryos.	QQT proteins colocalize with microtubules and are essential for early embryo development in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03072.x quatre-quart1 is an indispensable U12 intron-containing gene that plays a crucial role in Arabidopsis development.2017 · DOI: 10.1093/jxb/erx138

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015272 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009658 chloroplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0032502 developmental process Biological Process

GO:0051301 cell division Biological Process

GO:1902182 shoot apical meristem development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005819 spindle Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

KEGG gene cross-reference

ath:AT5G22370

mmu:100210

ssc:110255194

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.595

Rank 1 · TkA03G058080 · TK1151

Nucleus0.537

Rank 2 · TkA03G058080 · TK1151

Mitochondrion0.065

Rank 3 · TkA03G058080 · TK1151

Cell membrane0.056

Rank 4 · TkA03G058080 · TK1151

Endoplasmic reticulum0.054

Rank 5 · TkA03G058080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13604AAA_305-36 aa

PF00448SRP546-39 aa

PF08433KTI126-42 aa

PF13238AAA_186-44 aa

PF13401AAA_226-46 aa

PF13245AAA_196-35 aa

PF13671AAA_336-39 aa

PF13521AAA_286-25 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G058080	`PF13604`	AAA_30	5	36	0.008	16.7
TkA03G058080	`PF00448`	SRP54	6	39	0.0032	17.8
TkA03G058080	`PF08433`	KTI12	6	42	0.0063	16.8
TkA03G058080	`PF13238`	AAA_18	6	44	0.0079	17.4
TkA03G058080	`PF13401`	AAA_22	6	46	0.018	16.1
TkA03G058080	`PF13245`	AAA_19	6	35	0.019	15.8
TkA03G058080	`PF13671`	AAA_33	6	39	0.029	15.4
TkA03G058080	`PF13521`	AAA_28	6	25	0.038	14.9
TkA03G058080	`PF07728`	AAA_5	6	40	0.039	14.7
TkA03G058080	`PF13479`	AAA_24	6	55	0.041	14.3
TkA03G058080	`PF13191`	AAA_16	6	52	0.068	14.4
TkA03G058080	`PF13173`	AAA_14	6	47	0.075	13.8
TkA03G058080	`PF20720`	nSTAND3	6	33	0.075	13.4
TkA03G058080	`PF00910`	RNA_helicase	6	27	0.084	14.1
TkA03G058080	`PF00437`	T2SSE	6	55	0.092	12.1
TkA03G058080	`PF19975`	DO-GTPase1	6	27	0.16	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56XY2`	Arabidopsis thaliana	sp\|Q56XY2\|QQT1_ARATH GPN-loop GTPase QQT1	86.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card