TkA03G030350 | RubberDandelionOmics

Gene overview

TkA03G030350

Reference: TK1151 Chr: Chr03 Coordinates: 8138622-8143601 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2624 bp · TkA03G030350|TK1151|cDNA

TGAAAAATGACACCACAACGGTATTATTTTAATTTAACAACTTTGAAACTTTTGTCCAAAACTACATGACAAATTGCACATATAAATACGGGCACACAGGATGTGACAAAGATGGAAGACGGAGACGGTCACCAACTCCCACTGGCCCATTTCAAGACTCTTCAAACGGAAATTTGGGGCATAAATATGATCTGATTATATTAAATTTATCAACATCGTCCTTCGATTCATTTATTTATTGGATAGATTTGGATCCCCTT...

CDS

Download CDS FASTA

1755 bp · TkA03G030350|TK1151|CDS

ATGAGCTTCGAGAGTAGCATGGCGGAACTGGGAGTAGTAACTTGTACACACAAGCGTTCGAAAAGCTTTCCAGGAAACAACGAAGCTGAAGAAGATAACCAGAATACGAAAATTTCCACAAATTCGAAGTTGCCGAATGCAGAAATCCAAAATTCCTTGAGAAACGAGATATTACAGCTCGAAAAAAGATTACAAGACCAAGTTGCTGTTCGCGGTGCTTTAGAACAAGCTTTAGGTTATCGATCATCTTCCCTTCAAAT...

Protein

Download Protein FASTA

584 aa · TkA03G030350|TK1151|PROTEIN

MSFESSMAELGVVTCTHKRSKSFPGNNEAEEDNQNTKISTNSKLPNAEIQNSLRNEILQLEKRLQDQVAVRGALEQALGYRSSSLQITNQVSIPKPATELIKDIAVLEYEVSHLEQYLLSLYRKAFDQQISCPYGEALKSPLITPRGKYVETCRNDISLKLQETYNNGGVEEEEEDKEEEDIVLDSSVNRCHSSLSHHSIENPINTLGKELRACHSQPLSMMEYAQNNSSNLISLAEHLGTRICDHVPETPNKLSEDIIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G030350`
TK1151 ID	TkA03G030350
OH-1004 ID	LXL04_006379
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G030350`
Location	Chr03:8138622-8143601 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006379` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.516

Rank 1 · TkA03G030350 · TK1151

Nucleus0.384

Rank 2 · TkA03G030350 · TK1151

Cell membrane0.176

Rank 3 · TkA03G030350 · TK1151

Plastid0.053

Rank 4 · TkA03G030350 · TK1151

Endoplasmic reticulum0.053

Rank 5 · TkA03G030350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15546DUF465327-102 aa

PF25610HR1_TOCA41-121 aa

PF14389Lzipper-MIP148-128 aa

PF12761End361-118 aa

PF15546DUF4653267-290 aa

PF25610HR1_TOCA341-358 aa

PF04784DUF547371-505 aa

PF14389Lzipper-MIP1545-554 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G030350	`PF15546`	DUF4653	27	102	0.0064	16.9
TkA03G030350	`PF25610`	HR1_TOCA	41	121	0.31	12.1
TkA03G030350	`PF14389`	Lzipper-MIP1	48	128	9.9e-25	87.4
TkA03G030350	`PF12761`	End3	61	118	0.05	14.5
TkA03G030350	`PF15546`	DUF4653	267	290	0.0064	16.9
TkA03G030350	`PF25610`	HR1_TOCA	341	358	0.31	12.1
TkA03G030350	`PF04784`	DUF547	371	505	9e-42	142.7
TkA03G030350	`PF14389`	Lzipper-MIP1	545	554	9.9e-25	87.4
TkA03G030350	`PF25610`	HR1_TOCA	547	559	0.31	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card