Gene Card
Gene overview
cDNA / CDS / Protein Sequences
489 bp · TkA03G023560|TK1151|cDNA
ATGGCTCCTCTAGCTGAGCTCAAGCGCGCTCCTCGCGAGTCGCAACCTCGCCTCCTCTGCTTAACGCTCCTCAACCCTCGGACGCCATCTTCAACTTCGAATAAGCTTCTCGGTCGTCGGCCACGCTCTACCGGCTACCGGATTAGATATTGTGGTTCGGTTGTTCGTGAATCGAGAATTATGTCTCATATCCTTTCTGATATGTTTCCTTTCTCCGGTTGCAAATCGCCATTTTATGGAGGTGTCGGTGCTCCATTGCC...
489 bp · TkA03G023560|TK1151|CDS
ATGGCTCCTCTAGCTGAGCTCAAGCGCGCTCCTCGCGAGTCGCAACCTCGCCTCCTCTGCTTAACGCTCCTCAACCCTCGGACGCCATCTTCAACTTCGAATAAGCTTCTCGGTCGTCGGCCACGCTCTACCGGCTACCGGATTAGATATTGTGGTTCGGTTGTTCGTGAATCGAGAATTATGTCTCATATCCTTTCTGATATGTTTCCTTTCTCCGGTTGCAAATCGCCATTTTATGGAGGTGTCGGTGCTCCATTGCC...
Protein
Download Protein FASTA162 aa · TkA03G023560|TK1151|PROTEIN
MAPLAELKRAPRESQPRLLCLTLLNPRTPSSTSNKLLGRRPRSTGYRIRYCGSVVRESRIMSHILSDMFPFSGCKSPFYGGVGAPLPLDGTDLKLISVKINGNELKEGDYHVDARHLVVKSPPSGNFILETVTEILPQKNTSLEASRLITSVHNVKLKVSAI
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G023560 |
|---|---|
| TK1151 ID | TkA03G023560 |
| OH-1004 ID | LXL04_019211 |
| Relationship / confidence | Multi Candidate From Tk1151 / Complex relationship |
| Protein identity (%) | 95.800 |
| Protein coverage (%) | TK1151 88.889 / OH-1004 66.977Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G023560 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:6078092-6079597 (-) | ||||||||||||
| Description | Similar to Os08g0562700: Puromycin-sensitive aminopeptidase | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006508 proteolysis Biological Process GO:0005634 nucleus Cellular Component GO:0005773 vacuole Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0009570 chloroplast stroma Cellular Component GO:0009941 chloroplast envelope Cellular Component GO:0048046 apoplast Cellular Component GO:0004177 aminopeptidase activity Molecular Function GO:0008237 metallopeptidase activity Molecular Function GO:0008270 zinc ion binding Molecular Function GO:0016285 alanyl aminopeptidase activity Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT1G63770 ccr:CC_2481 dosa:Os08g0562700 ecj:JW0915 eco:b0932 ecoc:C3026_05725 hin:HI_1614 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.